Mutagenetix > Incidental Mutations

Incidental Mutation 'R2436:Vmn2r109'

249606

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r109

Ensembl Gene

ENSMUSG00000090572

Gene Name

vomeronasal 2, receptor 109

Synonyms

EG627814

MMRRC Submission

040397-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R2436 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20540517-20564756 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 20554536 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 186 (G186C)

Ref Sequence

ENSEMBL: ENSMUSP00000132641 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167093]

AlphaFold

K7N747

Predicted Effect

probably damaging
Transcript: ENSMUST00000167093
AA Change: G186C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: G186C

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	83	467	1.4e-35	PFAM
Pfam:NCD3G	510	563	3.1e-21	PFAM
Pfam:7tm_3	596	831	7.4e-52	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg7	A	G	16: 56,761,945	S277P	possibly damaging	Het
Arl6ip4	T	C	5: 124,116,599	S52P	probably benign	Het
Barx2	T	C	9: 31,913,087	H2R	probably damaging	Het
Calhm3	T	C	19: 47,151,965	T230A	probably damaging	Het
Card11	C	T	5: 140,882,362	V844M	possibly damaging	Het
Dnah6	C	T	6: 73,149,173	R1327Q	probably benign	Het
Ehbp1	C	A	11: 22,089,524		probably null	Het
Fgg	T	A	3: 83,014,189	I393N	possibly damaging	Het
Foxq1	A	T	13: 31,558,533		probably benign	Het
Hmgxb3	T	C	18: 61,147,494	T646A	probably benign	Het
Homer3	G	A	8: 70,293,056	E324K	possibly damaging	Het
Krt80	A	G	15: 101,359,503	F183L	probably damaging	Het
Map3k21	A	T	8: 125,941,615	K647*	probably null	Het
Mcm3ap	A	G	10: 76,490,057	Y1067C	probably damaging	Het
Myh1	G	T	11: 67,213,271	Q921H	probably benign	Het
Nme8	A	G	13: 19,677,859	F200S	probably damaging	Het
Nploc4	T	C	11: 120,418,317	N153S	possibly damaging	Het
Olfr1246	A	G	2: 89,590,773	V114A	probably benign	Het
Olfr173	C	T	16: 58,797,244	V201I	probably benign	Het
Olfr297	T	C	7: 86,527,383	F209L	probably damaging	Het
Olfr319	T	C	11: 58,702,126	C142R	probably damaging	Het
Pipox	T	A	11: 77,892,117	L86F	probably damaging	Het
Polr3h	G	T	15: 81,917,205	L157I	probably benign	Het
Prex2	G	A	1: 11,266,152	V1525M	possibly damaging	Het
Rapgef2	A	T	3: 79,088,772	D561E	possibly damaging	Het
Sacs	A	T	14: 61,202,905	D800V	possibly damaging	Het
Sbsn	A	T	7: 30,752,230	L223F	possibly damaging	Het
Slc16a9	TCCCC	TCCCCC	10: 70,256,081		probably null	Het
Srrm3	G	T	5: 135,835,176	E43*	probably null	Het
Tcaf3	G	A	6: 42,593,729	A363V	probably damaging	Het
Tmem138	A	G	19: 10,574,904	F78S	probably damaging	Het
Tnfrsf17	G	A	16: 11,319,812	D138N	probably damaging	Het
Tubgcp6	C	T	15: 89,102,365	V1344I	probably benign	Het
Usp24	T	A	4: 106,409,645	L1875*	probably null	Het
Wdr78	T	C	4: 103,066,352	I427V	probably benign	Het
Zfp541	A	G	7: 16,076,448	N137D	possibly damaging	Het

Other mutations in Vmn2r109

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01313:Vmn2r109	APN	17	20550157	missense	probably damaging	1.00
IGL01383:Vmn2r109	APN	17	20541121	missense	possibly damaging	0.89
IGL01469:Vmn2r109	APN	17	20541409	missense	probably damaging	1.00
IGL01762:Vmn2r109	APN	17	20554392	missense	probably benign
IGL01864:Vmn2r109	APN	17	20541134	missense	probably benign	0.28
IGL02028:Vmn2r109	APN	17	20541080	missense	probably benign	0.28
IGL02074:Vmn2r109	APN	17	20554341	missense	probably benign	0.05
IGL02162:Vmn2r109	APN	17	20554160	missense	probably benign	0.01
IGL02474:Vmn2r109	APN	17	20540888	missense	probably benign
IGL02490:Vmn2r109	APN	17	20540984	missense	possibly damaging	0.78
IGL02604:Vmn2r109	APN	17	20540701	missense	probably damaging	1.00
IGL02669:Vmn2r109	APN	17	20554256	missense	possibly damaging	0.64
IGL02705:Vmn2r109	APN	17	20553800	missense	probably benign
IGL02745:Vmn2r109	APN	17	20541250	missense	probably damaging	0.99
PIT4142001:Vmn2r109	UTSW	17	20554577	critical splice acceptor site	probably null
R0389:Vmn2r109	UTSW	17	20541074	missense	probably damaging	1.00
R0470:Vmn2r109	UTSW	17	20552886	missense	probably benign	0.06
R0570:Vmn2r109	UTSW	17	20540675	missense	probably damaging	0.99
R0855:Vmn2r109	UTSW	17	20541408	nonsense	probably null
R0882:Vmn2r109	UTSW	17	20554580	splice site	probably benign
R1241:Vmn2r109	UTSW	17	20555241	missense	possibly damaging	0.86
R1587:Vmn2r109	UTSW	17	20540740	missense	probably damaging	1.00
R1931:Vmn2r109	UTSW	17	20553810	nonsense	probably null
R1957:Vmn2r109	UTSW	17	20564707	missense	probably benign	0.11
R1962:Vmn2r109	UTSW	17	20553923	missense	probably damaging	0.99
R2020:Vmn2r109	UTSW	17	20541186	nonsense	probably null
R2073:Vmn2r109	UTSW	17	20564712	missense	probably benign	0.00
R3123:Vmn2r109	UTSW	17	20540986	missense	probably damaging	1.00
R3839:Vmn2r109	UTSW	17	20554442	missense	probably damaging	1.00
R4019:Vmn2r109	UTSW	17	20553812	missense	probably benign
R4428:Vmn2r109	UTSW	17	20553024	missense	probably benign
R4584:Vmn2r109	UTSW	17	20554558	nonsense	probably null
R4652:Vmn2r109	UTSW	17	20541394	missense	probably damaging	1.00
R4708:Vmn2r109	UTSW	17	20541343	missense	probably damaging	0.97
R4823:Vmn2r109	UTSW	17	20553891	missense	probably damaging	1.00
R4831:Vmn2r109	UTSW	17	20541232	missense	probably benign	0.01
R4907:Vmn2r109	UTSW	17	20550086	missense	probably damaging	1.00
R5011:Vmn2r109	UTSW	17	20555189	missense	probably damaging	1.00
R5296:Vmn2r109	UTSW	17	20554341	missense	possibly damaging	0.90
R5600:Vmn2r109	UTSW	17	20540927	missense	probably damaging	1.00
R5602:Vmn2r109	UTSW	17	20540671	missense	possibly damaging	0.94
R5652:Vmn2r109	UTSW	17	20540519	makesense	probably null
R5702:Vmn2r109	UTSW	17	20554145	missense	probably benign	0.42
R5706:Vmn2r109	UTSW	17	20554305	missense	probably benign	0.16
R5714:Vmn2r109	UTSW	17	20552859	missense	probably damaging	1.00
R5832:Vmn2r109	UTSW	17	20541056	missense	probably benign	0.10
R6008:Vmn2r109	UTSW	17	20540719	missense	probably damaging	1.00
R6334:Vmn2r109	UTSW	17	20541178	missense	probably benign	0.18
R6377:Vmn2r109	UTSW	17	20564534	critical splice donor site	probably null
R6738:Vmn2r109	UTSW	17	20554523	missense	possibly damaging	0.52
R6857:Vmn2r109	UTSW	17	20540670	missense	probably benign	0.45
R6953:Vmn2r109	UTSW	17	20540711	missense	possibly damaging	0.95
R7108:Vmn2r109	UTSW	17	20564744	missense	probably benign	0.03
R7229:Vmn2r109	UTSW	17	20540963	missense	possibly damaging	0.80
R7238:Vmn2r109	UTSW	17	20541074	missense	probably damaging	1.00
R7244:Vmn2r109	UTSW	17	20540683	missense	possibly damaging	0.70
R7292:Vmn2r109	UTSW	17	20541438	missense	probably benign	0.05
R7354:Vmn2r109	UTSW	17	20540781	missense	probably damaging	1.00
R7357:Vmn2r109	UTSW	17	20541274	missense	probably damaging	1.00
R7522:Vmn2r109	UTSW	17	20554403	missense	probably benign	0.11
R7596:Vmn2r109	UTSW	17	20540680	missense	probably damaging	0.98
R7728:Vmn2r109	UTSW	17	20552855	missense	probably damaging	0.99
R7859:Vmn2r109	UTSW	17	20541174	missense	probably damaging	1.00
R7871:Vmn2r109	UTSW	17	20540520	missense	probably benign	0.08
R8113:Vmn2r109	UTSW	17	20554467	missense	probably benign	0.01
R8153:Vmn2r109	UTSW	17	20564707	missense	probably benign	0.11
R8977:Vmn2r109	UTSW	17	20554269	missense	possibly damaging	0.96
Z1176:Vmn2r109	UTSW	17	20552994	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGGATCATTTTCACAAAAGCTATGC -3'
(R):5'- CCCTTGAAACTAACAGGTTTGGC -3'

Sequencing Primer
(F):5'- CACAAAAGCTATGCAGATGCCTTTTC -3'
(R):5'- CTAACAGGTTTGGCAGGAATTTC -3'

Posted On

2014-11-12