Incidental Mutation 'R2436:Vmn2r109'
ID 249606
Institutional Source Beutler Lab
Gene Symbol Vmn2r109
Ensembl Gene ENSMUSG00000090572
Gene Name vomeronasal 2, receptor 109
Synonyms EG627814
MMRRC Submission 040397-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R2436 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 20540517-20564756 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 20554536 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 186 (G186C)
Ref Sequence ENSEMBL: ENSMUSP00000132641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167093]
AlphaFold K7N747
Predicted Effect probably damaging
Transcript: ENSMUST00000167093
AA Change: G186C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: G186C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 1.4e-35 PFAM
Pfam:NCD3G 510 563 3.1e-21 PFAM
Pfam:7tm_3 596 831 7.4e-52 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,761,945 S277P possibly damaging Het
Arl6ip4 T C 5: 124,116,599 S52P probably benign Het
Barx2 T C 9: 31,913,087 H2R probably damaging Het
Calhm3 T C 19: 47,151,965 T230A probably damaging Het
Card11 C T 5: 140,882,362 V844M possibly damaging Het
Dnah6 C T 6: 73,149,173 R1327Q probably benign Het
Ehbp1 C A 11: 22,089,524 probably null Het
Fgg T A 3: 83,014,189 I393N possibly damaging Het
Foxq1 A T 13: 31,558,533 probably benign Het
Hmgxb3 T C 18: 61,147,494 T646A probably benign Het
Homer3 G A 8: 70,293,056 E324K possibly damaging Het
Krt80 A G 15: 101,359,503 F183L probably damaging Het
Map3k21 A T 8: 125,941,615 K647* probably null Het
Mcm3ap A G 10: 76,490,057 Y1067C probably damaging Het
Myh1 G T 11: 67,213,271 Q921H probably benign Het
Nme8 A G 13: 19,677,859 F200S probably damaging Het
Nploc4 T C 11: 120,418,317 N153S possibly damaging Het
Olfr1246 A G 2: 89,590,773 V114A probably benign Het
Olfr173 C T 16: 58,797,244 V201I probably benign Het
Olfr297 T C 7: 86,527,383 F209L probably damaging Het
Olfr319 T C 11: 58,702,126 C142R probably damaging Het
Pipox T A 11: 77,892,117 L86F probably damaging Het
Polr3h G T 15: 81,917,205 L157I probably benign Het
Prex2 G A 1: 11,266,152 V1525M possibly damaging Het
Rapgef2 A T 3: 79,088,772 D561E possibly damaging Het
Sacs A T 14: 61,202,905 D800V possibly damaging Het
Sbsn A T 7: 30,752,230 L223F possibly damaging Het
Slc16a9 TCCCC TCCCCC 10: 70,256,081 probably null Het
Srrm3 G T 5: 135,835,176 E43* probably null Het
Tcaf3 G A 6: 42,593,729 A363V probably damaging Het
Tmem138 A G 19: 10,574,904 F78S probably damaging Het
Tnfrsf17 G A 16: 11,319,812 D138N probably damaging Het
Tubgcp6 C T 15: 89,102,365 V1344I probably benign Het
Usp24 T A 4: 106,409,645 L1875* probably null Het
Wdr78 T C 4: 103,066,352 I427V probably benign Het
Zfp541 A G 7: 16,076,448 N137D possibly damaging Het
Other mutations in Vmn2r109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Vmn2r109 APN 17 20550157 missense probably damaging 1.00
IGL01383:Vmn2r109 APN 17 20541121 missense possibly damaging 0.89
IGL01469:Vmn2r109 APN 17 20541409 missense probably damaging 1.00
IGL01762:Vmn2r109 APN 17 20554392 missense probably benign
IGL01864:Vmn2r109 APN 17 20541134 missense probably benign 0.28
IGL02028:Vmn2r109 APN 17 20541080 missense probably benign 0.28
IGL02074:Vmn2r109 APN 17 20554341 missense probably benign 0.05
IGL02162:Vmn2r109 APN 17 20554160 missense probably benign 0.01
IGL02474:Vmn2r109 APN 17 20540888 missense probably benign
IGL02490:Vmn2r109 APN 17 20540984 missense possibly damaging 0.78
IGL02604:Vmn2r109 APN 17 20540701 missense probably damaging 1.00
IGL02669:Vmn2r109 APN 17 20554256 missense possibly damaging 0.64
IGL02705:Vmn2r109 APN 17 20553800 missense probably benign
IGL02745:Vmn2r109 APN 17 20541250 missense probably damaging 0.99
PIT4142001:Vmn2r109 UTSW 17 20554577 critical splice acceptor site probably null
R0389:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R0470:Vmn2r109 UTSW 17 20552886 missense probably benign 0.06
R0570:Vmn2r109 UTSW 17 20540675 missense probably damaging 0.99
R0855:Vmn2r109 UTSW 17 20541408 nonsense probably null
R0882:Vmn2r109 UTSW 17 20554580 splice site probably benign
R1241:Vmn2r109 UTSW 17 20555241 missense possibly damaging 0.86
R1587:Vmn2r109 UTSW 17 20540740 missense probably damaging 1.00
R1931:Vmn2r109 UTSW 17 20553810 nonsense probably null
R1957:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
R1962:Vmn2r109 UTSW 17 20553923 missense probably damaging 0.99
R2020:Vmn2r109 UTSW 17 20541186 nonsense probably null
R2073:Vmn2r109 UTSW 17 20564712 missense probably benign 0.00
R3123:Vmn2r109 UTSW 17 20540986 missense probably damaging 1.00
R3839:Vmn2r109 UTSW 17 20554442 missense probably damaging 1.00
R4019:Vmn2r109 UTSW 17 20553812 missense probably benign
R4428:Vmn2r109 UTSW 17 20553024 missense probably benign
R4584:Vmn2r109 UTSW 17 20554558 nonsense probably null
R4652:Vmn2r109 UTSW 17 20541394 missense probably damaging 1.00
R4708:Vmn2r109 UTSW 17 20541343 missense probably damaging 0.97
R4823:Vmn2r109 UTSW 17 20553891 missense probably damaging 1.00
R4831:Vmn2r109 UTSW 17 20541232 missense probably benign 0.01
R4907:Vmn2r109 UTSW 17 20550086 missense probably damaging 1.00
R5011:Vmn2r109 UTSW 17 20555189 missense probably damaging 1.00
R5296:Vmn2r109 UTSW 17 20554341 missense possibly damaging 0.90
R5600:Vmn2r109 UTSW 17 20540927 missense probably damaging 1.00
R5602:Vmn2r109 UTSW 17 20540671 missense possibly damaging 0.94
R5652:Vmn2r109 UTSW 17 20540519 makesense probably null
R5702:Vmn2r109 UTSW 17 20554145 missense probably benign 0.42
R5706:Vmn2r109 UTSW 17 20554305 missense probably benign 0.16
R5714:Vmn2r109 UTSW 17 20552859 missense probably damaging 1.00
R5832:Vmn2r109 UTSW 17 20541056 missense probably benign 0.10
R6008:Vmn2r109 UTSW 17 20540719 missense probably damaging 1.00
R6334:Vmn2r109 UTSW 17 20541178 missense probably benign 0.18
R6377:Vmn2r109 UTSW 17 20564534 critical splice donor site probably null
R6738:Vmn2r109 UTSW 17 20554523 missense possibly damaging 0.52
R6857:Vmn2r109 UTSW 17 20540670 missense probably benign 0.45
R6953:Vmn2r109 UTSW 17 20540711 missense possibly damaging 0.95
R7108:Vmn2r109 UTSW 17 20564744 missense probably benign 0.03
R7229:Vmn2r109 UTSW 17 20540963 missense possibly damaging 0.80
R7238:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R7244:Vmn2r109 UTSW 17 20540683 missense possibly damaging 0.70
R7292:Vmn2r109 UTSW 17 20541438 missense probably benign 0.05
R7354:Vmn2r109 UTSW 17 20540781 missense probably damaging 1.00
R7357:Vmn2r109 UTSW 17 20541274 missense probably damaging 1.00
R7522:Vmn2r109 UTSW 17 20554403 missense probably benign 0.11
R7596:Vmn2r109 UTSW 17 20540680 missense probably damaging 0.98
R7728:Vmn2r109 UTSW 17 20552855 missense probably damaging 0.99
R7859:Vmn2r109 UTSW 17 20541174 missense probably damaging 1.00
R7871:Vmn2r109 UTSW 17 20540520 missense probably benign 0.08
R8113:Vmn2r109 UTSW 17 20554467 missense probably benign 0.01
R8153:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
R8977:Vmn2r109 UTSW 17 20554269 missense possibly damaging 0.96
Z1176:Vmn2r109 UTSW 17 20552994 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGATCATTTTCACAAAAGCTATGC -3'
(R):5'- CCCTTGAAACTAACAGGTTTGGC -3'

Sequencing Primer
(F):5'- CACAAAAGCTATGCAGATGCCTTTTC -3'
(R):5'- CTAACAGGTTTGGCAGGAATTTC -3'
Posted On 2014-11-12