Incidental Mutation 'R2436:Hmgxb3'
ID249607
Institutional Source Beutler Lab
Gene Symbol Hmgxb3
Ensembl Gene ENSMUSG00000024622
Gene NameHMG box domain containing 3
Synonyms2510002C16Rik, A630042L21Rik
MMRRC Submission 040397-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock #R2436 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location61131279-61177050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61147494 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 646 (T646A)
Ref Sequence ENSEMBL: ENSMUSP00000089498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091884]
Predicted Effect probably benign
Transcript: ENSMUST00000091884
AA Change: T646A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000089498
Gene: ENSMUSG00000024622
AA Change: T646A

DomainStartEndE-ValueType
HMG 40 110 6.8e-15 SMART
low complexity region 182 194 N/A INTRINSIC
internal_repeat_1 307 336 1.98e-9 PROSPERO
internal_repeat_1 583 612 1.98e-9 PROSPERO
low complexity region 817 830 N/A INTRINSIC
low complexity region 966 977 N/A INTRINSIC
low complexity region 1239 1254 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of the non-canonical high mobility group (HMG) genes. The encoded protein contains an HMG-box domain found in DNA binding proteins such as transcription factors and chromosomal proteins. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,761,945 S277P possibly damaging Het
Arl6ip4 T C 5: 124,116,599 S52P probably benign Het
Barx2 T C 9: 31,913,087 H2R probably damaging Het
Calhm3 T C 19: 47,151,965 T230A probably damaging Het
Card11 C T 5: 140,882,362 V844M possibly damaging Het
Dnah6 C T 6: 73,149,173 R1327Q probably benign Het
Ehbp1 C A 11: 22,089,524 probably null Het
Fgg T A 3: 83,014,189 I393N possibly damaging Het
Foxq1 A T 13: 31,558,533 probably benign Het
Homer3 G A 8: 70,293,056 E324K possibly damaging Het
Krt80 A G 15: 101,359,503 F183L probably damaging Het
Map3k21 A T 8: 125,941,615 K647* probably null Het
Mcm3ap A G 10: 76,490,057 Y1067C probably damaging Het
Myh1 G T 11: 67,213,271 Q921H probably benign Het
Nme8 A G 13: 19,677,859 F200S probably damaging Het
Nploc4 T C 11: 120,418,317 N153S possibly damaging Het
Olfr1246 A G 2: 89,590,773 V114A probably benign Het
Olfr173 C T 16: 58,797,244 V201I probably benign Het
Olfr297 T C 7: 86,527,383 F209L probably damaging Het
Olfr319 T C 11: 58,702,126 C142R probably damaging Het
Pipox T A 11: 77,892,117 L86F probably damaging Het
Polr3h G T 15: 81,917,205 L157I probably benign Het
Prex2 G A 1: 11,266,152 V1525M possibly damaging Het
Rapgef2 A T 3: 79,088,772 D561E possibly damaging Het
Sacs A T 14: 61,202,905 D800V possibly damaging Het
Sbsn A T 7: 30,752,230 L223F possibly damaging Het
Slc16a9 TCCCC TCCCCC 10: 70,256,081 probably null Het
Srrm3 G T 5: 135,835,176 E43* probably null Het
Tcaf3 G A 6: 42,593,729 A363V probably damaging Het
Tmem138 A G 19: 10,574,904 F78S probably damaging Het
Tnfrsf17 G A 16: 11,319,812 D138N probably damaging Het
Tubgcp6 C T 15: 89,102,365 V1344I probably benign Het
Usp24 T A 4: 106,409,645 L1875* probably null Het
Vmn2r109 C A 17: 20,554,536 G186C probably damaging Het
Wdr78 T C 4: 103,066,352 I427V probably benign Het
Zfp541 A G 7: 16,076,448 N137D possibly damaging Het
Other mutations in Hmgxb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Hmgxb3 APN 18 61157739 missense probably benign 0.00
IGL01325:Hmgxb3 APN 18 61134006 missense probably damaging 1.00
IGL01364:Hmgxb3 APN 18 61146434 missense probably damaging 0.96
IGL02160:Hmgxb3 APN 18 61171236 missense probably damaging 1.00
IGL02271:Hmgxb3 APN 18 61132213 missense probably damaging 1.00
IGL02755:Hmgxb3 APN 18 61172188 missense probably damaging 1.00
R0309:Hmgxb3 UTSW 18 61155128 splice site probably benign
R0828:Hmgxb3 UTSW 18 61171354 missense probably damaging 1.00
R1276:Hmgxb3 UTSW 18 61165504 missense probably benign 0.04
R1429:Hmgxb3 UTSW 18 61150433 missense probably damaging 0.98
R1491:Hmgxb3 UTSW 18 61133908 missense probably benign 0.04
R1675:Hmgxb3 UTSW 18 61135559 missense probably damaging 1.00
R1886:Hmgxb3 UTSW 18 61137401 critical splice donor site probably null
R1887:Hmgxb3 UTSW 18 61137401 critical splice donor site probably null
R2070:Hmgxb3 UTSW 18 61171359 missense probably damaging 1.00
R2084:Hmgxb3 UTSW 18 61155023 splice site probably benign
R2110:Hmgxb3 UTSW 18 61155386 missense possibly damaging 0.54
R2112:Hmgxb3 UTSW 18 61155386 missense possibly damaging 0.54
R2149:Hmgxb3 UTSW 18 61157674 missense probably benign 0.08
R2342:Hmgxb3 UTSW 18 61162991 missense possibly damaging 0.89
R2898:Hmgxb3 UTSW 18 61155296 missense probably benign 0.00
R2975:Hmgxb3 UTSW 18 61162966 nonsense probably null
R3110:Hmgxb3 UTSW 18 61147382 missense probably damaging 1.00
R3111:Hmgxb3 UTSW 18 61147382 missense probably damaging 1.00
R3112:Hmgxb3 UTSW 18 61147382 missense probably damaging 1.00
R4327:Hmgxb3 UTSW 18 61167539 missense probably benign 0.11
R4710:Hmgxb3 UTSW 18 61137475 missense probably damaging 1.00
R4750:Hmgxb3 UTSW 18 61167496 missense probably benign
R4876:Hmgxb3 UTSW 18 61146534 missense possibly damaging 0.94
R5177:Hmgxb3 UTSW 18 61172194 missense probably damaging 1.00
R5490:Hmgxb3 UTSW 18 61162977 missense probably damaging 0.99
R5601:Hmgxb3 UTSW 18 61137622 missense probably damaging 1.00
R5718:Hmgxb3 UTSW 18 61140837 missense probably benign 0.05
R6011:Hmgxb3 UTSW 18 61163024 missense probably damaging 0.97
R6034:Hmgxb3 UTSW 18 61132522 missense probably damaging 1.00
R6034:Hmgxb3 UTSW 18 61132522 missense probably damaging 1.00
R6092:Hmgxb3 UTSW 18 61137600 missense possibly damaging 0.56
R6142:Hmgxb3 UTSW 18 61136237 missense probably benign 0.00
R6419:Hmgxb3 UTSW 18 61152224 missense possibly damaging 0.71
R6675:Hmgxb3 UTSW 18 61137576 missense possibly damaging 0.86
R7130:Hmgxb3 UTSW 18 61132378 missense probably benign
R7431:Hmgxb3 UTSW 18 61147445 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAATGGGCTGCTACAGAG -3'
(R):5'- AACGTTATTTCCCACCCTGAG -3'

Sequencing Primer
(F):5'- CTGCTACAGAGAAGGCACTGC -3'
(R):5'- ATTTCCCACCCTGAGTCATGGG -3'
Posted On2014-11-12