Incidental Mutation 'R2436:Tmem138'
ID249608
Institutional Source Beutler Lab
Gene Symbol Tmem138
Ensembl Gene ENSMUSG00000024666
Gene Nametransmembrane protein 138
Synonyms1700113I01Rik, 2900055D14Rik
MMRRC Submission 040397-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2436 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location10570478-10577362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10574904 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 78 (F78S)
Ref Sequence ENSEMBL: ENSMUSP00000025568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025568] [ENSMUST00000168445]
Predicted Effect probably damaging
Transcript: ENSMUST00000025568
AA Change: F78S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025568
Gene: ENSMUSG00000024666
AA Change: F78S

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:TMEM138 38 156 4.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168445
SMART Domains Protein: ENSMUSP00000130680
Gene: ENSMUSG00000034445

DomainStartEndE-ValueType
B561 46 175 1.47e-40 SMART
low complexity region 205 219 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass transmembrane protein. Reduced expression of this gene in mouse fibroblasts causes short cilia and failure of ciliogenesis. Expression of this gene is tightly coordinated with expression of the neighboring gene TMEM216. Mutations in this gene are associated with the autosomal recessive neurodevelopmental disorder Joubert Syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,761,945 S277P possibly damaging Het
Arl6ip4 T C 5: 124,116,599 S52P probably benign Het
Barx2 T C 9: 31,913,087 H2R probably damaging Het
Calhm3 T C 19: 47,151,965 T230A probably damaging Het
Card11 C T 5: 140,882,362 V844M possibly damaging Het
Dnah6 C T 6: 73,149,173 R1327Q probably benign Het
Ehbp1 C A 11: 22,089,524 probably null Het
Fgg T A 3: 83,014,189 I393N possibly damaging Het
Foxq1 A T 13: 31,558,533 probably benign Het
Hmgxb3 T C 18: 61,147,494 T646A probably benign Het
Homer3 G A 8: 70,293,056 E324K possibly damaging Het
Krt80 A G 15: 101,359,503 F183L probably damaging Het
Map3k21 A T 8: 125,941,615 K647* probably null Het
Mcm3ap A G 10: 76,490,057 Y1067C probably damaging Het
Myh1 G T 11: 67,213,271 Q921H probably benign Het
Nme8 A G 13: 19,677,859 F200S probably damaging Het
Nploc4 T C 11: 120,418,317 N153S possibly damaging Het
Olfr1246 A G 2: 89,590,773 V114A probably benign Het
Olfr173 C T 16: 58,797,244 V201I probably benign Het
Olfr297 T C 7: 86,527,383 F209L probably damaging Het
Olfr319 T C 11: 58,702,126 C142R probably damaging Het
Pipox T A 11: 77,892,117 L86F probably damaging Het
Polr3h G T 15: 81,917,205 L157I probably benign Het
Prex2 G A 1: 11,266,152 V1525M possibly damaging Het
Rapgef2 A T 3: 79,088,772 D561E possibly damaging Het
Sacs A T 14: 61,202,905 D800V possibly damaging Het
Sbsn A T 7: 30,752,230 L223F possibly damaging Het
Slc16a9 TCCCC TCCCCC 10: 70,256,081 probably null Het
Srrm3 G T 5: 135,835,176 E43* probably null Het
Tcaf3 G A 6: 42,593,729 A363V probably damaging Het
Tnfrsf17 G A 16: 11,319,812 D138N probably damaging Het
Tubgcp6 C T 15: 89,102,365 V1344I probably benign Het
Usp24 T A 4: 106,409,645 L1875* probably null Het
Vmn2r109 C A 17: 20,554,536 G186C probably damaging Het
Wdr78 T C 4: 103,066,352 I427V probably benign Het
Zfp541 A G 7: 16,076,448 N137D possibly damaging Het
Other mutations in Tmem138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01993:Tmem138 APN 19 10571588 missense probably benign
R0103:Tmem138 UTSW 19 10574952 missense possibly damaging 0.49
R0103:Tmem138 UTSW 19 10574952 missense possibly damaging 0.49
R0384:Tmem138 UTSW 19 10574822 unclassified probably benign
R2259:Tmem138 UTSW 19 10571603 missense probably benign 0.13
R5176:Tmem138 UTSW 19 10575270 missense probably benign
R6137:Tmem138 UTSW 19 10574835 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGTCCTCAGAGAACTAAGATTACAGG -3'
(R):5'- ACTTAGGGCCACCTCCTAAG -3'

Sequencing Primer
(F):5'- TGTGTAGATCCAGCATGACC -3'
(R):5'- AGGGCCACCTCCTAAGTCCTC -3'
Posted On2014-11-12