Incidental Mutation 'R2436:Calhm3'
ID249609
Institutional Source Beutler Lab
Gene Symbol Calhm3
Ensembl Gene ENSMUSG00000094219
Gene Namecalcium homeostasis modulator 3
Synonyms
MMRRC Submission 040397-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R2436 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location47151609-47157764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47151965 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 230 (T230A)
Ref Sequence ENSEMBL: ENSMUSP00000136302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178630]
Predicted Effect probably damaging
Transcript: ENSMUST00000178630
AA Change: T230A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136302
Gene: ENSMUSG00000094219
AA Change: T230A

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 1 252 1.9e-103 PFAM
low complexity region 268 278 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,761,945 S277P possibly damaging Het
Arl6ip4 T C 5: 124,116,599 S52P probably benign Het
Barx2 T C 9: 31,913,087 H2R probably damaging Het
Card11 C T 5: 140,882,362 V844M possibly damaging Het
Dnah6 C T 6: 73,149,173 R1327Q probably benign Het
Ehbp1 C A 11: 22,089,524 probably null Het
Fgg T A 3: 83,014,189 I393N possibly damaging Het
Foxq1 A T 13: 31,558,533 probably benign Het
Hmgxb3 T C 18: 61,147,494 T646A probably benign Het
Homer3 G A 8: 70,293,056 E324K possibly damaging Het
Krt80 A G 15: 101,359,503 F183L probably damaging Het
Map3k21 A T 8: 125,941,615 K647* probably null Het
Mcm3ap A G 10: 76,490,057 Y1067C probably damaging Het
Myh1 G T 11: 67,213,271 Q921H probably benign Het
Nme8 A G 13: 19,677,859 F200S probably damaging Het
Nploc4 T C 11: 120,418,317 N153S possibly damaging Het
Olfr1246 A G 2: 89,590,773 V114A probably benign Het
Olfr173 C T 16: 58,797,244 V201I probably benign Het
Olfr297 T C 7: 86,527,383 F209L probably damaging Het
Olfr319 T C 11: 58,702,126 C142R probably damaging Het
Pipox T A 11: 77,892,117 L86F probably damaging Het
Polr3h G T 15: 81,917,205 L157I probably benign Het
Prex2 G A 1: 11,266,152 V1525M possibly damaging Het
Rapgef2 A T 3: 79,088,772 D561E possibly damaging Het
Sacs A T 14: 61,202,905 D800V possibly damaging Het
Sbsn A T 7: 30,752,230 L223F possibly damaging Het
Slc16a9 TCCCC TCCCCC 10: 70,256,081 probably null Het
Srrm3 G T 5: 135,835,176 E43* probably null Het
Tcaf3 G A 6: 42,593,729 A363V probably damaging Het
Tmem138 A G 19: 10,574,904 F78S probably damaging Het
Tnfrsf17 G A 16: 11,319,812 D138N probably damaging Het
Tubgcp6 C T 15: 89,102,365 V1344I probably benign Het
Usp24 T A 4: 106,409,645 L1875* probably null Het
Vmn2r109 C A 17: 20,554,536 G186C probably damaging Het
Wdr78 T C 4: 103,066,352 I427V probably benign Het
Zfp541 A G 7: 16,076,448 N137D possibly damaging Het
Other mutations in Calhm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Calhm3 UTSW 19 47151896 frame shift probably null
R1203:Calhm3 UTSW 19 47155400 missense probably damaging 1.00
R1863:Calhm3 UTSW 19 47152100 missense probably damaging 1.00
R1911:Calhm3 UTSW 19 47155469 missense possibly damaging 0.74
R1951:Calhm3 UTSW 19 47151817 missense probably benign 0.00
R2089:Calhm3 UTSW 19 47151991 missense probably damaging 1.00
R2091:Calhm3 UTSW 19 47151991 missense probably damaging 1.00
R2273:Calhm3 UTSW 19 47157547 missense probably damaging 0.96
R2274:Calhm3 UTSW 19 47157547 missense probably damaging 0.96
R3702:Calhm3 UTSW 19 47151748 missense possibly damaging 0.88
R5758:Calhm3 UTSW 19 47151751 missense probably damaging 0.99
R5901:Calhm3 UTSW 19 47157613 missense probably damaging 1.00
R5938:Calhm3 UTSW 19 47152077 missense probably damaging 1.00
R6948:Calhm3 UTSW 19 47151905 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGTACTGAGGAGTTGATCCACC -3'
(R):5'- ACATCTCACTAAAGCCTTCTCG -3'

Sequencing Primer
(F):5'- GAGTTGATCCACCTGCTCCCG -3'
(R):5'- AAAGCCTTCTCGTCCTCCAGG -3'
Posted On2014-11-12