Incidental Mutation 'R2437:Tuba4a'
ID249614
Institutional Source Beutler Lab
Gene Symbol Tuba4a
Ensembl Gene ENSMUSG00000026202
Gene Nametubulin, alpha 4A
SynonymsTuba4, M[a]4
MMRRC Submission 040398-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.367) question?
Stock #R2437 (G1)
Quality Score180
Status Validated
Chromosome1
Chromosomal Location75214228-75219865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75217425 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 4 (I4V)
Ref Sequence ENSEMBL: ENSMUSP00000140881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027401] [ENSMUST00000179573] [ENSMUST00000180101] [ENSMUST00000186213] [ENSMUST00000186758] [ENSMUST00000188460] [ENSMUST00000188593] [ENSMUST00000189131] [ENSMUST00000189698] [ENSMUST00000190717] [ENSMUST00000191108]
Predicted Effect probably benign
Transcript: ENSMUST00000027401
SMART Domains Protein: ENSMUSP00000027401
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 290 3.3e-47 PFAM
Pfam:Pkinase_Tyr 21 290 3e-28 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000079464
AA Change: I33V
SMART Domains Protein: ENSMUSP00000078429
Gene: ENSMUSG00000026202
AA Change: I33V

DomainStartEndE-ValueType
Tubulin 49 246 4.34e-79 SMART
Tubulin_C 248 393 7.88e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126328
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156012
Predicted Effect probably benign
Transcript: ENSMUST00000179573
Predicted Effect probably benign
Transcript: ENSMUST00000180101
Predicted Effect probably benign
Transcript: ENSMUST00000186213
AA Change: I5V

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140657
Gene: ENSMUSG00000026202
AA Change: I5V

DomainStartEndE-ValueType
Tubulin 49 246 4.34e-79 SMART
Tubulin_C 248 393 7.88e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186350
Predicted Effect probably benign
Transcript: ENSMUST00000186758
SMART Domains Protein: ENSMUSP00000140552
Gene: ENSMUSG00000026202

DomainStartEndE-ValueType
Pfam:Tubulin 1 100 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187103
Predicted Effect probably benign
Transcript: ENSMUST00000188460
SMART Domains Protein: ENSMUSP00000139998
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
S_TKc 20 172 1e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188593
AA Change: I4V

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140881
Gene: ENSMUSG00000026202
AA Change: I4V

DomainStartEndE-ValueType
Pfam:Tubulin 2 75 2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189131
SMART Domains Protein: ENSMUSP00000140970
Gene: ENSMUSG00000026202

DomainStartEndE-ValueType
Pfam:Tubulin 1 81 3.6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189242
Predicted Effect probably benign
Transcript: ENSMUST00000189698
SMART Domains Protein: ENSMUSP00000140329
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
S_TKc 20 203 1.1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190717
SMART Domains Protein: ENSMUSP00000141097
Gene: ENSMUSG00000026202

DomainStartEndE-ValueType
Pfam:Tubulin 1 89 1.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191108
SMART Domains Protein: ENSMUSP00000139846
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 186 8.6e-29 PFAM
Pfam:Pkinase_Tyr 21 184 2.1e-14 PFAM
Meta Mutation Damage Score 0.1753 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulin. The genes encoding these microtubule constituents are part of the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes and they are highly conserved among and between species. This gene encodes an alpha tubulin that is a highly conserved homolog of a rat testis-specific alpha tubulin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,946,618 *635W probably null Het
4921507P07Rik T A 6: 50,583,979 D212V probably damaging Het
4932438A13Rik T A 3: 36,958,685 probably null Het
Anxa2 A G 9: 69,489,764 Y317C probably damaging Het
Arhgef26 T C 3: 62,432,581 S675P probably damaging Het
Camk2d A G 3: 126,834,628 N53S probably damaging Het
Carns1 A T 19: 4,165,783 M800K possibly damaging Het
Ces1f A T 8: 93,270,139 probably null Het
Chrne T A 11: 70,615,260 D426V possibly damaging Het
Cntfr T C 4: 41,671,035 T43A probably damaging Het
Cntn5 A T 9: 10,048,753 C63* probably null Het
Col12a1 G A 9: 79,692,219 T884I probably damaging Het
Dnah5 T C 15: 28,307,391 probably null Het
Dnajc2 A T 5: 21,760,391 S537R probably benign Het
Dnajc25 T C 4: 59,020,234 I100T probably damaging Het
Ephx1 C A 1: 180,996,096 G149C probably damaging Het
Fam163b G T 2: 27,112,686 P100T probably damaging Het
Fgd5 A T 6: 92,062,869 R1017* probably null Het
Fibin A T 2: 110,362,503 L98Q probably damaging Het
Fndc3b A T 3: 27,451,332 L929H probably damaging Het
Frem1 T A 4: 83,000,173 S512C probably damaging Het
Gm4922 T A 10: 18,784,081 M298L probably benign Het
Gstm2 G A 3: 107,984,053 probably benign Het
Gtf3c2 A G 5: 31,159,698 probably null Het
Ibtk A C 9: 85,708,125 L1026V probably benign Het
Il9 T A 13: 56,481,871 probably benign Het
Inpp4a T C 1: 37,392,956 S146P probably damaging Het
Kcnab1 G T 3: 65,357,014 probably benign Het
Lrrc29 A G 8: 105,313,043 probably null Het
Mgat4c T C 10: 102,388,575 S217P probably damaging Het
Mr1 T C 1: 155,132,531 M233V probably benign Het
Ncoa2 G A 1: 13,148,360 T1415I probably damaging Het
Oasl2 G A 5: 114,911,296 D486N probably benign Het
Olfr1412 T C 1: 92,588,966 I212T possibly damaging Het
Olfr342 A T 2: 36,528,246 Y278F probably damaging Het
Olfr461 G A 6: 40,544,922 T19I probably benign Het
Pcnx4 T C 12: 72,541,813 F132L probably damaging Het
Pde5a T A 3: 122,843,053 L717Q probably damaging Het
Peli2 A T 14: 48,227,932 probably benign Het
Phf14 A G 6: 11,962,658 S435G probably damaging Het
Plekhg1 T A 10: 3,963,564 H1095Q probably damaging Het
Plekhh2 A G 17: 84,586,479 probably null Het
Plekho1 T G 3: 95,992,185 N99H probably damaging Het
Plxnc1 T A 10: 94,906,533 K457N probably benign Het
Ppp1r3a T C 6: 14,718,323 E864G probably benign Het
Prkab2 T A 3: 97,667,399 L237Q probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptger3 T A 3: 157,567,570 C185S probably damaging Het
Ptprk T C 10: 28,354,713 Y267H probably damaging Het
Pum2 A G 12: 8,744,654 I715V probably benign Het
R3hdm1 T C 1: 128,186,836 V518A probably damaging Het
Rab3d T C 9: 21,915,851 I28V probably damaging Het
Rad54b T C 4: 11,606,272 L560P probably damaging Het
Rgs20 A G 1: 5,070,147 probably null Het
Sesn1 T A 10: 41,905,319 L460H probably damaging Het
Slc39a14 A G 14: 70,316,436 probably null Het
Slco6c1 T A 1: 97,062,476 H663L probably benign Het
Snx13 T A 12: 35,082,927 C63S probably benign Het
Strip2 T C 6: 29,941,941 probably null Het
Syncrip A G 9: 88,479,567 probably benign Het
Taf15 A G 11: 83,504,753 probably benign Het
Tbc1d8 T C 1: 39,405,287 probably null Het
Tgm4 T A 9: 123,048,549 C205* probably null Het
Tmem212 A T 3: 27,886,479 L63Q possibly damaging Het
Tmem63a G A 1: 180,962,489 probably null Het
Trpm5 C A 7: 143,082,561 V525L probably benign Het
Ttn A G 2: 76,706,827 L34919P probably damaging Het
Ttn T C 2: 76,864,275 probably benign Het
Ubr4 A G 4: 139,473,542 D4679G possibly damaging Het
Usp2 T G 9: 44,092,148 V448G probably damaging Het
Usp3 A G 9: 66,545,742 probably null Het
Zfp341 T A 2: 154,628,801 V246E probably damaging Het
Other mutations in Tuba4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Tuba4a APN 1 75217277 missense probably damaging 1.00
andropov UTSW 1 75217394 missense probably damaging 1.00
R0453:Tuba4a UTSW 1 75215858 missense probably damaging 1.00
R0573:Tuba4a UTSW 1 75216373 missense probably benign 0.01
R1488:Tuba4a UTSW 1 75216401 missense probably benign 0.08
R1660:Tuba4a UTSW 1 75215903 missense probably benign 0.35
R1836:Tuba4a UTSW 1 75216110 missense probably benign 0.20
R2012:Tuba4a UTSW 1 75216339 nonsense probably null
R4180:Tuba4a UTSW 1 75215782 missense probably benign 0.33
R5505:Tuba4a UTSW 1 75216416 missense probably damaging 1.00
R6137:Tuba4a UTSW 1 75216055 missense probably damaging 1.00
R6189:Tuba4a UTSW 1 75216874 missense probably benign 0.34
R6566:Tuba4a UTSW 1 75217286 missense probably damaging 1.00
R6837:Tuba4a UTSW 1 75217394 missense probably damaging 1.00
R6883:Tuba4a UTSW 1 75217422 missense probably damaging 1.00
R7213:Tuba4a UTSW 1 75215697 missense possibly damaging 0.86
R7765:Tuba4a UTSW 1 75216359 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GGCACATGTTTTCCAGCTCC -3'
(R):5'- TCTCTACTGAGAAGTAGGCTAAGGG -3'

Sequencing Primer
(F):5'- TTCCAGCTCCAGTTTCACAGAAG -3'
(R):5'- TGGCTACCTCCAGTCTGG -3'
Posted On2014-11-12