Incidental Mutation 'R2437:Olfr1412'
ID 249615
Institutional Source Beutler Lab
Gene Symbol Olfr1412
Ensembl Gene ENSMUSG00000046300
Gene Name olfactory receptor 1412
Synonyms GA_x6K02T2R7CC-81165686-81164721, MOR208-4
MMRRC Submission 040398-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R2437 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 92585779-92591375 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92588966 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 212 (I212T)
Ref Sequence ENSEMBL: ENSMUSP00000150943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062964] [ENSMUST00000190505]
AlphaFold Q8VET3
Predicted Effect possibly damaging
Transcript: ENSMUST00000062964
AA Change: I212T

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000060291
Gene: ENSMUSG00000046300
AA Change: I212T

DomainStartEndE-ValueType
transmembrane domain 10 27 N/A INTRINSIC
Pfam:7tm_4 38 314 7.8e-47 PFAM
Pfam:7tm_1 48 321 1.4e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190505
AA Change: I212T

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204141
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,946,618 *635W probably null Het
4921507P07Rik T A 6: 50,583,979 D212V probably damaging Het
4932438A13Rik T A 3: 36,958,685 probably null Het
Anxa2 A G 9: 69,489,764 Y317C probably damaging Het
Arhgef26 T C 3: 62,432,581 S675P probably damaging Het
Camk2d A G 3: 126,834,628 N53S probably damaging Het
Carns1 A T 19: 4,165,783 M800K possibly damaging Het
Ces1f A T 8: 93,270,139 probably null Het
Chrne T A 11: 70,615,260 D426V possibly damaging Het
Cntfr T C 4: 41,671,035 T43A probably damaging Het
Cntn5 A T 9: 10,048,753 C63* probably null Het
Col12a1 G A 9: 79,692,219 T884I probably damaging Het
Dnah5 T C 15: 28,307,391 probably null Het
Dnajc2 A T 5: 21,760,391 S537R probably benign Het
Dnajc25 T C 4: 59,020,234 I100T probably damaging Het
Ephx1 C A 1: 180,996,096 G149C probably damaging Het
Fam163b G T 2: 27,112,686 P100T probably damaging Het
Fgd5 A T 6: 92,062,869 R1017* probably null Het
Fibin A T 2: 110,362,503 L98Q probably damaging Het
Fndc3b A T 3: 27,451,332 L929H probably damaging Het
Frem1 T A 4: 83,000,173 S512C probably damaging Het
Gm4922 T A 10: 18,784,081 M298L probably benign Het
Gstm2 G A 3: 107,984,053 probably benign Het
Gtf3c2 A G 5: 31,159,698 probably null Het
Ibtk A C 9: 85,708,125 L1026V probably benign Het
Il9 T A 13: 56,481,871 probably benign Het
Inpp4a T C 1: 37,392,956 S146P probably damaging Het
Kcnab1 G T 3: 65,357,014 probably benign Het
Lrrc29 A G 8: 105,313,043 probably null Het
Mgat4c T C 10: 102,388,575 S217P probably damaging Het
Mr1 T C 1: 155,132,531 M233V probably benign Het
Ncoa2 G A 1: 13,148,360 T1415I probably damaging Het
Oasl2 G A 5: 114,911,296 D486N probably benign Het
Olfr342 A T 2: 36,528,246 Y278F probably damaging Het
Olfr461 G A 6: 40,544,922 T19I probably benign Het
Pcnx4 T C 12: 72,541,813 F132L probably damaging Het
Pde5a T A 3: 122,843,053 L717Q probably damaging Het
Peli2 A T 14: 48,227,932 probably benign Het
Phf14 A G 6: 11,962,658 S435G probably damaging Het
Plekhg1 T A 10: 3,963,564 H1095Q probably damaging Het
Plekhh2 A G 17: 84,586,479 probably null Het
Plekho1 T G 3: 95,992,185 N99H probably damaging Het
Plxnc1 T A 10: 94,906,533 K457N probably benign Het
Ppp1r3a T C 6: 14,718,323 E864G probably benign Het
Prkab2 T A 3: 97,667,399 L237Q probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptger3 T A 3: 157,567,570 C185S probably damaging Het
Ptprk T C 10: 28,354,713 Y267H probably damaging Het
Pum2 A G 12: 8,744,654 I715V probably benign Het
R3hdm1 T C 1: 128,186,836 V518A probably damaging Het
Rab3d T C 9: 21,915,851 I28V probably damaging Het
Rad54b T C 4: 11,606,272 L560P probably damaging Het
Rgs20 A G 1: 5,070,147 probably null Het
Sesn1 T A 10: 41,905,319 L460H probably damaging Het
Slc39a14 A G 14: 70,316,436 probably null Het
Slco6c1 T A 1: 97,062,476 H663L probably benign Het
Snx13 T A 12: 35,082,927 C63S probably benign Het
Strip2 T C 6: 29,941,941 probably null Het
Syncrip A G 9: 88,479,567 probably benign Het
Taf15 A G 11: 83,504,753 probably benign Het
Tbc1d8 T C 1: 39,405,287 probably null Het
Tgm4 T A 9: 123,048,549 C205* probably null Het
Tmem212 A T 3: 27,886,479 L63Q possibly damaging Het
Tmem63a G A 1: 180,962,489 probably null Het
Trpm5 C A 7: 143,082,561 V525L probably benign Het
Ttn A G 2: 76,706,827 L34919P probably damaging Het
Ttn T C 2: 76,864,275 probably benign Het
Tuba4a T C 1: 75,217,425 I4V possibly damaging Het
Ubr4 A G 4: 139,473,542 D4679G possibly damaging Het
Usp2 T G 9: 44,092,148 V448G probably damaging Het
Usp3 A G 9: 66,545,742 probably null Het
Zfp341 T A 2: 154,628,801 V246E probably damaging Het
Other mutations in Olfr1412
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Olfr1412 APN 1 92588972 missense possibly damaging 0.52
IGL02177:Olfr1412 APN 1 92588757 missense possibly damaging 0.96
IGL02507:Olfr1412 APN 1 92588926 missense possibly damaging 0.68
IGL02888:Olfr1412 APN 1 92589203 missense probably damaging 1.00
IGL03001:Olfr1412 APN 1 92588551 missense probably damaging 1.00
R1771:Olfr1412 UTSW 1 92589115 missense probably benign 0.03
R1780:Olfr1412 UTSW 1 92588389 missense probably benign 0.01
R2215:Olfr1412 UTSW 1 92588986 missense probably benign 0.00
R3176:Olfr1412 UTSW 1 92588813 missense probably benign 0.32
R3177:Olfr1412 UTSW 1 92588813 missense probably benign 0.32
R3276:Olfr1412 UTSW 1 92588813 missense probably benign 0.32
R3277:Olfr1412 UTSW 1 92588813 missense probably benign 0.32
R4475:Olfr1412 UTSW 1 92588579 missense probably benign 0.00
R4892:Olfr1412 UTSW 1 92588921 missense probably benign 0.05
R5910:Olfr1412 UTSW 1 92588707 missense probably damaging 1.00
R6808:Olfr1412 UTSW 1 92589046 missense probably damaging 0.99
R7130:Olfr1412 UTSW 1 92588912 missense probably benign 0.10
R7476:Olfr1412 UTSW 1 92589264 missense probably benign
Z1088:Olfr1412 UTSW 1 92588551 missense probably damaging 1.00
Z1177:Olfr1412 UTSW 1 92588378 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCATGTCCTCCACAGTCTG -3'
(R):5'- TTAGATGCCAAACCTCCTGG -3'

Sequencing Primer
(F):5'- ACAGTCTGTGCTTGCCTTG -3'
(R):5'- TGGCTGGCCATATATAGCAATCC -3'
Posted On 2014-11-12