Incidental Mutation 'R2437:Ephx1'
ID249621
Institutional Source Beutler Lab
Gene Symbol Ephx1
Ensembl Gene ENSMUSG00000038776
Gene Nameepoxide hydrolase 1, microsomal
SynonymsEph-1, mEH, Eph1
MMRRC Submission 040398-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R2437 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location180976210-181020904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 180996096 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 149 (G149C)
Ref Sequence ENSEMBL: ENSMUSP00000106697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036928] [ENSMUST00000111068] [ENSMUST00000147585]
Predicted Effect probably damaging
Transcript: ENSMUST00000036928
AA Change: G149C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047551
Gene: ENSMUSG00000038776
AA Change: G149C

DomainStartEndE-ValueType
Pfam:EHN 50 160 2.1e-36 PFAM
Pfam:Abhydrolase_1 142 404 2.1e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111068
AA Change: G149C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106697
Gene: ENSMUSG00000038776
AA Change: G149C

DomainStartEndE-ValueType
Pfam:EHN 49 161 4.2e-38 PFAM
Pfam:Abhydrolase_6 144 430 3.7e-10 PFAM
Pfam:Abhydrolase_1 178 254 1.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147585
SMART Domains Protein: ENSMUSP00000122671
Gene: ENSMUSG00000038776

DomainStartEndE-ValueType
Pfam:EHN 49 130 2.6e-26 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000154133
AA Change: G25C
SMART Domains Protein: ENSMUSP00000114363
Gene: ENSMUSG00000038776
AA Change: G25C

DomainStartEndE-ValueType
Pfam:EHN 1 37 1.2e-8 PFAM
Pfam:Abhydrolase_1 19 247 2.3e-26 PFAM
Meta Mutation Damage Score 0.9674 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Epoxide hydrolase is a critical biotransformation enzyme that converts epoxides from the degradation of aromatic compounds to trans-dihydrodiols which can be conjugated and excreted from the body. Epoxide hydrolase functions in both the activation and detoxification of epoxides. Mutations in this gene cause preeclampsia, epoxide hydrolase deficiency or increased epoxide hydrolase activity. Alternatively spliced transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly resistant to DMBA-induced skin carcinogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,946,618 *635W probably null Het
4921507P07Rik T A 6: 50,583,979 D212V probably damaging Het
4932438A13Rik T A 3: 36,958,685 probably null Het
Anxa2 A G 9: 69,489,764 Y317C probably damaging Het
Arhgef26 T C 3: 62,432,581 S675P probably damaging Het
Camk2d A G 3: 126,834,628 N53S probably damaging Het
Carns1 A T 19: 4,165,783 M800K possibly damaging Het
Ces1f A T 8: 93,270,139 probably null Het
Chrne T A 11: 70,615,260 D426V possibly damaging Het
Cntfr T C 4: 41,671,035 T43A probably damaging Het
Cntn5 A T 9: 10,048,753 C63* probably null Het
Col12a1 G A 9: 79,692,219 T884I probably damaging Het
Dnah5 T C 15: 28,307,391 probably null Het
Dnajc2 A T 5: 21,760,391 S537R probably benign Het
Dnajc25 T C 4: 59,020,234 I100T probably damaging Het
Fam163b G T 2: 27,112,686 P100T probably damaging Het
Fgd5 A T 6: 92,062,869 R1017* probably null Het
Fibin A T 2: 110,362,503 L98Q probably damaging Het
Fndc3b A T 3: 27,451,332 L929H probably damaging Het
Frem1 T A 4: 83,000,173 S512C probably damaging Het
Gm4922 T A 10: 18,784,081 M298L probably benign Het
Gstm2 G A 3: 107,984,053 probably benign Het
Gtf3c2 A G 5: 31,159,698 probably null Het
Ibtk A C 9: 85,708,125 L1026V probably benign Het
Il9 T A 13: 56,481,871 probably benign Het
Inpp4a T C 1: 37,392,956 S146P probably damaging Het
Kcnab1 G T 3: 65,357,014 probably benign Het
Lrrc29 A G 8: 105,313,043 probably null Het
Mgat4c T C 10: 102,388,575 S217P probably damaging Het
Mr1 T C 1: 155,132,531 M233V probably benign Het
Ncoa2 G A 1: 13,148,360 T1415I probably damaging Het
Oasl2 G A 5: 114,911,296 D486N probably benign Het
Olfr1412 T C 1: 92,588,966 I212T possibly damaging Het
Olfr342 A T 2: 36,528,246 Y278F probably damaging Het
Olfr461 G A 6: 40,544,922 T19I probably benign Het
Pcnx4 T C 12: 72,541,813 F132L probably damaging Het
Pde5a T A 3: 122,843,053 L717Q probably damaging Het
Peli2 A T 14: 48,227,932 probably benign Het
Phf14 A G 6: 11,962,658 S435G probably damaging Het
Plekhg1 T A 10: 3,963,564 H1095Q probably damaging Het
Plekhh2 A G 17: 84,586,479 probably null Het
Plekho1 T G 3: 95,992,185 N99H probably damaging Het
Plxnc1 T A 10: 94,906,533 K457N probably benign Het
Ppp1r3a T C 6: 14,718,323 E864G probably benign Het
Prkab2 T A 3: 97,667,399 L237Q probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptger3 T A 3: 157,567,570 C185S probably damaging Het
Ptprk T C 10: 28,354,713 Y267H probably damaging Het
Pum2 A G 12: 8,744,654 I715V probably benign Het
R3hdm1 T C 1: 128,186,836 V518A probably damaging Het
Rab3d T C 9: 21,915,851 I28V probably damaging Het
Rad54b T C 4: 11,606,272 L560P probably damaging Het
Rgs20 A G 1: 5,070,147 probably null Het
Sesn1 T A 10: 41,905,319 L460H probably damaging Het
Slc39a14 A G 14: 70,316,436 probably null Het
Slco6c1 T A 1: 97,062,476 H663L probably benign Het
Snx13 T A 12: 35,082,927 C63S probably benign Het
Strip2 T C 6: 29,941,941 probably null Het
Syncrip A G 9: 88,479,567 probably benign Het
Taf15 A G 11: 83,504,753 probably benign Het
Tbc1d8 T C 1: 39,405,287 probably null Het
Tgm4 T A 9: 123,048,549 C205* probably null Het
Tmem212 A T 3: 27,886,479 L63Q possibly damaging Het
Tmem63a G A 1: 180,962,489 probably null Het
Trpm5 C A 7: 143,082,561 V525L probably benign Het
Ttn A G 2: 76,706,827 L34919P probably damaging Het
Ttn T C 2: 76,864,275 probably benign Het
Tuba4a T C 1: 75,217,425 I4V possibly damaging Het
Ubr4 A G 4: 139,473,542 D4679G possibly damaging Het
Usp2 T G 9: 44,092,148 V448G probably damaging Het
Usp3 A G 9: 66,545,742 probably null Het
Zfp341 T A 2: 154,628,801 V246E probably damaging Het
Other mutations in Ephx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Ephx1 APN 1 180999821 missense possibly damaging 0.82
IGL00864:Ephx1 APN 1 180990451 missense probably damaging 1.00
IGL00972:Ephx1 APN 1 180999800 missense probably benign 0.02
IGL01577:Ephx1 APN 1 181001980 start codon destroyed probably null 0.96
IGL02718:Ephx1 APN 1 180999786 missense probably damaging 1.00
IGL03330:Ephx1 APN 1 180999806 missense possibly damaging 0.53
R1190:Ephx1 UTSW 1 180993929 missense probably benign 0.24
R1751:Ephx1 UTSW 1 180994677 missense probably damaging 1.00
R1767:Ephx1 UTSW 1 180994677 missense probably damaging 1.00
R2484:Ephx1 UTSW 1 180989972 missense probably damaging 1.00
R3623:Ephx1 UTSW 1 180989933 missense probably benign 0.35
R3696:Ephx1 UTSW 1 180989951 missense probably benign 0.03
R4674:Ephx1 UTSW 1 180994691 missense probably damaging 1.00
R4675:Ephx1 UTSW 1 180994691 missense probably damaging 1.00
R4769:Ephx1 UTSW 1 180995978 missense possibly damaging 0.62
R4883:Ephx1 UTSW 1 181001923 missense possibly damaging 0.76
R6827:Ephx1 UTSW 1 180989888 missense probably damaging 1.00
R6974:Ephx1 UTSW 1 180999722 critical splice donor site probably null
R7147:Ephx1 UTSW 1 181001819 missense probably damaging 0.96
R7847:Ephx1 UTSW 1 181001861 missense probably benign 0.00
R7930:Ephx1 UTSW 1 181001861 missense probably benign 0.00
Z1177:Ephx1 UTSW 1 180999769 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AATAGGACTTAGAGTGGTGCTGTC -3'
(R):5'- CACGTGGATGATAGTTGCTCC -3'

Sequencing Primer
(F):5'- ATGACAGTCTGGATGTCCCTTCAG -3'
(R):5'- ATGATAGTTGCTCCACAGGACTGTC -3'
Posted On2014-11-12