Mutagenetix > Incidental Mutations

Incidental Mutation 'R2437:Kcnab1'

249633

Institutional Source

Beutler Lab

Gene Symbol

Kcnab1

Ensembl Gene

ENSMUSG00000027827

Gene Name

potassium voltage-gated channel, shaker-related subfamily, beta member 1

Synonyms

Kvbeta1.1, mKv(beta)1, Akr8a8

MMRRC Submission

040398-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R2437 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65109384-65378223 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to T at 65357014 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000047480 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049230]

Predicted Effect

probably benign
Transcript: ENSMUST00000049230

SMART Domains

Protein: ENSMUSP00000047480
Gene: ENSMUSG00000027827

Domain	Start	End	E-Value	Type
Pfam:Aldo_ket_red	85	390	1.8e-73	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159525

SMART Domains

Protein: ENSMUSP00000124311
Gene: ENSMUSG00000027827

Domain	Start	End	E-Value	Type
Pfam:Aldo_ket_red	85	343	1.3e-60	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160136

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161404

SMART Domains

Protein: ENSMUSP00000125578
Gene: ENSMUSG00000027827

Domain	Start	End	E-Value	Type
Pfam:Aldo_ket_red	1	284	4e-68	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161956

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161979

SMART Domains

Protein: ENSMUSP00000125050
Gene: ENSMUSG00000027827

Domain	Start	End	E-Value	Type
Pfam:Aldo_ket_red	50	355	1.2e-73	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member includes distinct isoforms which are encoded by alternatively spliced transcript variants of this gene. Some of these isoforms are beta subunits, which form heteromultimeric complexes with alpha subunits and modulate the activity of the pore-forming alpha subunits. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some learning defects but are otherwise normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	A	G	4: 147,946,618	*635W	probably null	Het
4921507P07Rik	T	A	6: 50,583,979	D212V	probably damaging	Het
4932438A13Rik	T	A	3: 36,958,685		probably null	Het
Anxa2	A	G	9: 69,489,764	Y317C	probably damaging	Het
Arhgef26	T	C	3: 62,432,581	S675P	probably damaging	Het
Camk2d	A	G	3: 126,834,628	N53S	probably damaging	Het
Carns1	A	T	19: 4,165,783	M800K	possibly damaging	Het
Ces1f	A	T	8: 93,270,139		probably null	Het
Chrne	T	A	11: 70,615,260	D426V	possibly damaging	Het
Cntfr	T	C	4: 41,671,035	T43A	probably damaging	Het
Cntn5	A	T	9: 10,048,753	C63*	probably null	Het
Col12a1	G	A	9: 79,692,219	T884I	probably damaging	Het
Dnah5	T	C	15: 28,307,391		probably null	Het
Dnajc2	A	T	5: 21,760,391	S537R	probably benign	Het
Dnajc25	T	C	4: 59,020,234	I100T	probably damaging	Het
Ephx1	C	A	1: 180,996,096	G149C	probably damaging	Het
Fam163b	G	T	2: 27,112,686	P100T	probably damaging	Het
Fgd5	A	T	6: 92,062,869	R1017*	probably null	Het
Fibin	A	T	2: 110,362,503	L98Q	probably damaging	Het
Fndc3b	A	T	3: 27,451,332	L929H	probably damaging	Het
Frem1	T	A	4: 83,000,173	S512C	probably damaging	Het
Gm4922	T	A	10: 18,784,081	M298L	probably benign	Het
Gstm2	G	A	3: 107,984,053		probably benign	Het
Gtf3c2	A	G	5: 31,159,698		probably null	Het
Ibtk	A	C	9: 85,708,125	L1026V	probably benign	Het
Il9	T	A	13: 56,481,871		probably benign	Het
Inpp4a	T	C	1: 37,392,956	S146P	probably damaging	Het
Lrrc29	A	G	8: 105,313,043		probably null	Het
Mgat4c	T	C	10: 102,388,575	S217P	probably damaging	Het
Mr1	T	C	1: 155,132,531	M233V	probably benign	Het
Ncoa2	G	A	1: 13,148,360	T1415I	probably damaging	Het
Oasl2	G	A	5: 114,911,296	D486N	probably benign	Het
Olfr1412	T	C	1: 92,588,966	I212T	possibly damaging	Het
Olfr342	A	T	2: 36,528,246	Y278F	probably damaging	Het
Olfr461	G	A	6: 40,544,922	T19I	probably benign	Het
Pcnx4	T	C	12: 72,541,813	F132L	probably damaging	Het
Pde5a	T	A	3: 122,843,053	L717Q	probably damaging	Het
Peli2	A	T	14: 48,227,932		probably benign	Het
Phf14	A	G	6: 11,962,658	S435G	probably damaging	Het
Plekhg1	T	A	10: 3,963,564	H1095Q	probably damaging	Het
Plekhh2	A	G	17: 84,586,479		probably null	Het
Plekho1	T	G	3: 95,992,185	N99H	probably damaging	Het
Plxnc1	T	A	10: 94,906,533	K457N	probably benign	Het
Ppp1r3a	T	C	6: 14,718,323	E864G	probably benign	Het
Prkab2	T	A	3: 97,667,399	L237Q	probably damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptger3	T	A	3: 157,567,570	C185S	probably damaging	Het
Ptprk	T	C	10: 28,354,713	Y267H	probably damaging	Het
Pum2	A	G	12: 8,744,654	I715V	probably benign	Het
R3hdm1	T	C	1: 128,186,836	V518A	probably damaging	Het
Rab3d	T	C	9: 21,915,851	I28V	probably damaging	Het
Rad54b	T	C	4: 11,606,272	L560P	probably damaging	Het
Rgs20	A	G	1: 5,070,147		probably null	Het
Sesn1	T	A	10: 41,905,319	L460H	probably damaging	Het
Slc39a14	A	G	14: 70,316,436		probably null	Het
Slco6c1	T	A	1: 97,062,476	H663L	probably benign	Het
Snx13	T	A	12: 35,082,927	C63S	probably benign	Het
Strip2	T	C	6: 29,941,941		probably null	Het
Syncrip	A	G	9: 88,479,567		probably benign	Het
Taf15	A	G	11: 83,504,753		probably benign	Het
Tbc1d8	T	C	1: 39,405,287		probably null	Het
Tgm4	T	A	9: 123,048,549	C205*	probably null	Het
Tmem212	A	T	3: 27,886,479	L63Q	possibly damaging	Het
Tmem63a	G	A	1: 180,962,489		probably null	Het
Trpm5	C	A	7: 143,082,561	V525L	probably benign	Het
Ttn	A	G	2: 76,706,827	L34919P	probably damaging	Het
Ttn	T	C	2: 76,864,275		probably benign	Het
Tuba4a	T	C	1: 75,217,425	I4V	possibly damaging	Het
Ubr4	A	G	4: 139,473,542	D4679G	possibly damaging	Het
Usp2	T	G	9: 44,092,148	V448G	probably damaging	Het
Usp3	A	G	9: 66,545,742		probably null	Het
Zfp341	T	A	2: 154,628,801	V246E	probably damaging	Het

Other mutations in Kcnab1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01819:Kcnab1	APN	3	65319454	missense	probably damaging	1.00
IGL01936:Kcnab1	APN	3	65358274	missense	probably damaging	1.00
IGL02291:Kcnab1	APN	3	65357082	missense	possibly damaging	0.94
IGL02425:Kcnab1	APN	3	65302179	missense	possibly damaging	0.59
PIT4418001:Kcnab1	UTSW	3	65358320	missense	probably benign	0.12
R0017:Kcnab1	UTSW	3	65357106	missense	probably damaging	0.98
R0017:Kcnab1	UTSW	3	65357106	missense	probably damaging	0.98
R0811:Kcnab1	UTSW	3	65297720	missense	probably damaging	1.00
R0812:Kcnab1	UTSW	3	65297720	missense	probably damaging	1.00
R1847:Kcnab1	UTSW	3	65302194	critical splice donor site	probably null
R1926:Kcnab1	UTSW	3	65376512	missense	possibly damaging	0.73
R2064:Kcnab1	UTSW	3	65364639	missense	probably benign	0.07
R2152:Kcnab1	UTSW	3	65371440	missense	probably damaging	0.99
R2153:Kcnab1	UTSW	3	65371440	missense	probably damaging	0.99
R2197:Kcnab1	UTSW	3	65109947	missense	probably benign	0.00
R2233:Kcnab1	UTSW	3	65319467	missense	probably damaging	1.00
R2235:Kcnab1	UTSW	3	65319467	missense	probably damaging	1.00
R3916:Kcnab1	UTSW	3	65304164	critical splice donor site	probably null
R4093:Kcnab1	UTSW	3	65299614	missense	possibly damaging	0.96
R4347:Kcnab1	UTSW	3	65297475	intron	probably benign
R4796:Kcnab1	UTSW	3	65304165	critical splice donor site	probably null
R5588:Kcnab1	UTSW	3	65376555	missense	possibly damaging	0.59
R7254:Kcnab1	UTSW	3	65319487	missense	probably benign	0.08
R7347:Kcnab1	UTSW	3	65376531	missense	probably benign	0.07
R7424:Kcnab1	UTSW	3	65266503	missense	possibly damaging	0.80
Z1177:Kcnab1	UTSW	3	65266510	missense	probably damaging	0.99
Z1177:Kcnab1	UTSW	3	65357133	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- CTAATTTGCCCCAGACTTTACTCAG -3'
(R):5'- AGTCACTGATCCTCACATTGTG -3'

Sequencing Primer
(F):5'- GAATAACAAGGATTCCCCACATTTGG -3'
(R):5'- CCTCACATTGTGAAGAATAAGCAG -3'

Posted On

2014-11-12