Incidental Mutation 'R2437:Gstm2'
ID249636
Institutional Source Beutler Lab
Gene Symbol Gstm2
Ensembl Gene ENSMUSG00000040562
Gene Nameglutathione S-transferase, mu 2
SynonymsGstb2, Gstb-2
MMRRC Submission 040398-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R2437 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location107981702-107986453 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 107984053 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000066675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012348] [ENSMUST00000066530]
Predicted Effect probably benign
Transcript: ENSMUST00000012348
SMART Domains Protein: ENSMUSP00000012348
Gene: ENSMUSG00000040562

DomainStartEndE-ValueType
Pfam:GST_N 3 82 2.9e-24 PFAM
Pfam:GST_C_3 41 190 1.2e-10 PFAM
Pfam:GST_C 104 191 5.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066530
SMART Domains Protein: ENSMUSP00000066675
Gene: ENSMUSG00000040562

DomainStartEndE-ValueType
Pfam:GST_N 1 48 6.8e-12 PFAM
Pfam:GST_C 70 158 8.4e-20 PFAM
Pfam:GST_C_3 84 156 1.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150808
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Null mutations of this class mu gene have been linked with an increase in a number of cancers, likely due to an increased susceptibility to environmental toxins and carcinogens. Multiple protein isoforms are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,946,618 *635W probably null Het
4921507P07Rik T A 6: 50,583,979 D212V probably damaging Het
4932438A13Rik T A 3: 36,958,685 probably null Het
Anxa2 A G 9: 69,489,764 Y317C probably damaging Het
Arhgef26 T C 3: 62,432,581 S675P probably damaging Het
Camk2d A G 3: 126,834,628 N53S probably damaging Het
Carns1 A T 19: 4,165,783 M800K possibly damaging Het
Ces1f A T 8: 93,270,139 probably null Het
Chrne T A 11: 70,615,260 D426V possibly damaging Het
Cntfr T C 4: 41,671,035 T43A probably damaging Het
Cntn5 A T 9: 10,048,753 C63* probably null Het
Col12a1 G A 9: 79,692,219 T884I probably damaging Het
Dnah5 T C 15: 28,307,391 probably null Het
Dnajc2 A T 5: 21,760,391 S537R probably benign Het
Dnajc25 T C 4: 59,020,234 I100T probably damaging Het
Ephx1 C A 1: 180,996,096 G149C probably damaging Het
Fam163b G T 2: 27,112,686 P100T probably damaging Het
Fgd5 A T 6: 92,062,869 R1017* probably null Het
Fibin A T 2: 110,362,503 L98Q probably damaging Het
Fndc3b A T 3: 27,451,332 L929H probably damaging Het
Frem1 T A 4: 83,000,173 S512C probably damaging Het
Gm4922 T A 10: 18,784,081 M298L probably benign Het
Gtf3c2 A G 5: 31,159,698 probably null Het
Ibtk A C 9: 85,708,125 L1026V probably benign Het
Il9 T A 13: 56,481,871 probably benign Het
Inpp4a T C 1: 37,392,956 S146P probably damaging Het
Kcnab1 G T 3: 65,357,014 probably benign Het
Lrrc29 A G 8: 105,313,043 probably null Het
Mgat4c T C 10: 102,388,575 S217P probably damaging Het
Mr1 T C 1: 155,132,531 M233V probably benign Het
Ncoa2 G A 1: 13,148,360 T1415I probably damaging Het
Oasl2 G A 5: 114,911,296 D486N probably benign Het
Olfr1412 T C 1: 92,588,966 I212T possibly damaging Het
Olfr342 A T 2: 36,528,246 Y278F probably damaging Het
Olfr461 G A 6: 40,544,922 T19I probably benign Het
Pcnx4 T C 12: 72,541,813 F132L probably damaging Het
Pde5a T A 3: 122,843,053 L717Q probably damaging Het
Peli2 A T 14: 48,227,932 probably benign Het
Phf14 A G 6: 11,962,658 S435G probably damaging Het
Plekhg1 T A 10: 3,963,564 H1095Q probably damaging Het
Plekhh2 A G 17: 84,586,479 probably null Het
Plekho1 T G 3: 95,992,185 N99H probably damaging Het
Plxnc1 T A 10: 94,906,533 K457N probably benign Het
Ppp1r3a T C 6: 14,718,323 E864G probably benign Het
Prkab2 T A 3: 97,667,399 L237Q probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptger3 T A 3: 157,567,570 C185S probably damaging Het
Ptprk T C 10: 28,354,713 Y267H probably damaging Het
Pum2 A G 12: 8,744,654 I715V probably benign Het
R3hdm1 T C 1: 128,186,836 V518A probably damaging Het
Rab3d T C 9: 21,915,851 I28V probably damaging Het
Rad54b T C 4: 11,606,272 L560P probably damaging Het
Rgs20 A G 1: 5,070,147 probably null Het
Sesn1 T A 10: 41,905,319 L460H probably damaging Het
Slc39a14 A G 14: 70,316,436 probably null Het
Slco6c1 T A 1: 97,062,476 H663L probably benign Het
Snx13 T A 12: 35,082,927 C63S probably benign Het
Strip2 T C 6: 29,941,941 probably null Het
Syncrip A G 9: 88,479,567 probably benign Het
Taf15 A G 11: 83,504,753 probably benign Het
Tbc1d8 T C 1: 39,405,287 probably null Het
Tgm4 T A 9: 123,048,549 C205* probably null Het
Tmem212 A T 3: 27,886,479 L63Q possibly damaging Het
Tmem63a G A 1: 180,962,489 probably null Het
Trpm5 C A 7: 143,082,561 V525L probably benign Het
Ttn A G 2: 76,706,827 L34919P probably damaging Het
Ttn T C 2: 76,864,275 probably benign Het
Tuba4a T C 1: 75,217,425 I4V possibly damaging Het
Ubr4 A G 4: 139,473,542 D4679G possibly damaging Het
Usp2 T G 9: 44,092,148 V448G probably damaging Het
Usp3 A G 9: 66,545,742 probably null Het
Zfp341 T A 2: 154,628,801 V246E probably damaging Het
Other mutations in Gstm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Gstm2 APN 3 107985243 splice site probably null
IGL01821:Gstm2 APN 3 107985053 missense possibly damaging 0.51
IGL02662:Gstm2 APN 3 107985062 missense possibly damaging 0.94
IGL02667:Gstm2 APN 3 107986108 missense probably damaging 1.00
IGL03088:Gstm2 APN 3 107986046 missense probably benign 0.00
IGL03341:Gstm2 APN 3 107984205 missense possibly damaging 0.86
R0415:Gstm2 UTSW 3 107984006 missense probably benign 0.37
R1239:Gstm2 UTSW 3 107984028 missense possibly damaging 0.61
R2213:Gstm2 UTSW 3 107986093 missense probably damaging 1.00
R3765:Gstm2 UTSW 3 107984030 missense probably damaging 1.00
R4402:Gstm2 UTSW 3 107986054 missense probably benign 0.02
R4805:Gstm2 UTSW 3 107985095 missense possibly damaging 0.92
R5791:Gstm2 UTSW 3 107984128 critical splice donor site probably null
R6918:Gstm2 UTSW 3 107985241 splice site probably null
R7669:Gstm2 UTSW 3 107985676 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCACACAAAACGCAGGGTG -3'
(R):5'- CTGTGTCTGAAAGTGGTGACAG -3'

Sequencing Primer
(F):5'- TGAACACAGTTCCATGCTTAAC -3'
(R):5'- ACAGTTGTTTTCTGCTTCAGGAG -3'
Posted On2014-11-12