Incidental Mutation 'R2437:Dnah5'
ID 249684
Institutional Source Beutler Lab
Gene Symbol Dnah5
Ensembl Gene ENSMUSG00000022262
Gene Name dynein, axonemal, heavy chain 5
Synonyms b2b1565Clo, b2b1134Clo, Mdnah5, b2b1537Clo, b2b1154Clo, Dnahc5
MMRRC Submission 040398-MU
Accession Numbers

NCBI RefSeq: NM_133365.3; MGI: 107718
Essential gene? Probably essential (E-score: 0.776) question?
Stock # R2437 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 28203752-28472052 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 28307391 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067048]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000067048
SMART Domains Protein: ENSMUSP00000069751
Gene: ENSMUSG00000022262

DomainStartEndE-ValueType
Pfam:DHC_N1 247 802 2.3e-163 PFAM
low complexity region 1077 1088 N/A INTRINSIC
low complexity region 1113 1128 N/A INTRINSIC
Pfam:DHC_N2 1399 1807 2.3e-134 PFAM
AAA 1972 2108 2e-3 SMART
AAA 2251 2424 4.3e-3 SMART
AAA 2579 2777 2.2e-3 SMART
low complexity region 2874 2889 N/A INTRINSIC
Pfam:AAA_8 2914 3186 3.2e-70 PFAM
Pfam:MT 3198 3546 1e-44 PFAM
Pfam:AAA_9 3567 3792 1.4e-86 PFAM
low complexity region 3889 3899 N/A INTRINSIC
Pfam:Dynein_heavy 3930 4618 4.4e-246 PFAM
Meta Mutation Damage Score 0.9484 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (75/75)
MGI Phenotype Strain: 2180081
Lethality: D14-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dynein protein, which is part of a microtubule-associated motor protein complex consisting of heavy, light, and intermediate chains. This protein is an axonemal heavy chain dynein. It functions as a force-generating protein with ATPase activity, whereby the release of ADP is thought to produce the force-producing power stroke. Mutations in this gene cause primary ciliary dyskinesia type 3, as well as Kartagener syndrome, which are both diseases due to ciliary defects. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display postnatal lethality, hydrocephalus, respiratory infections, situs inversus and ciliary immotility. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(2) Gene trapped(1) Transgenic(1) Chemically induced(7)
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,946,618 *635W probably null Het
4921507P07Rik T A 6: 50,583,979 D212V probably damaging Het
4932438A13Rik T A 3: 36,958,685 probably null Het
Anxa2 A G 9: 69,489,764 Y317C probably damaging Het
Arhgef26 T C 3: 62,432,581 S675P probably damaging Het
Camk2d A G 3: 126,834,628 N53S probably damaging Het
Carns1 A T 19: 4,165,783 M800K possibly damaging Het
Ces1f A T 8: 93,270,139 probably null Het
Chrne T A 11: 70,615,260 D426V possibly damaging Het
Cntfr T C 4: 41,671,035 T43A probably damaging Het
Cntn5 A T 9: 10,048,753 C63* probably null Het
Col12a1 G A 9: 79,692,219 T884I probably damaging Het
Dnajc2 A T 5: 21,760,391 S537R probably benign Het
Dnajc25 T C 4: 59,020,234 I100T probably damaging Het
Ephx1 C A 1: 180,996,096 G149C probably damaging Het
Fam163b G T 2: 27,112,686 P100T probably damaging Het
Fgd5 A T 6: 92,062,869 R1017* probably null Het
Fibin A T 2: 110,362,503 L98Q probably damaging Het
Fndc3b A T 3: 27,451,332 L929H probably damaging Het
Frem1 T A 4: 83,000,173 S512C probably damaging Het
Gm4922 T A 10: 18,784,081 M298L probably benign Het
Gstm2 G A 3: 107,984,053 probably benign Het
Gtf3c2 A G 5: 31,159,698 probably null Het
Ibtk A C 9: 85,708,125 L1026V probably benign Het
Il9 T A 13: 56,481,871 probably benign Het
Inpp4a T C 1: 37,392,956 S146P probably damaging Het
Kcnab1 G T 3: 65,357,014 probably benign Het
Lrrc29 A G 8: 105,313,043 probably null Het
Mgat4c T C 10: 102,388,575 S217P probably damaging Het
Mr1 T C 1: 155,132,531 M233V probably benign Het
Ncoa2 G A 1: 13,148,360 T1415I probably damaging Het
Oasl2 G A 5: 114,911,296 D486N probably benign Het
Olfr1412 T C 1: 92,588,966 I212T possibly damaging Het
Olfr342 A T 2: 36,528,246 Y278F probably damaging Het
Olfr461 G A 6: 40,544,922 T19I probably benign Het
Pcnx4 T C 12: 72,541,813 F132L probably damaging Het
Pde5a T A 3: 122,843,053 L717Q probably damaging Het
Peli2 A T 14: 48,227,932 probably benign Het
Phf14 A G 6: 11,962,658 S435G probably damaging Het
Plekhg1 T A 10: 3,963,564 H1095Q probably damaging Het
Plekhh2 A G 17: 84,586,479 probably null Het
Plekho1 T G 3: 95,992,185 N99H probably damaging Het
Plxnc1 T A 10: 94,906,533 K457N probably benign Het
Ppp1r3a T C 6: 14,718,323 E864G probably benign Het
Prkab2 T A 3: 97,667,399 L237Q probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptger3 T A 3: 157,567,570 C185S probably damaging Het
Ptprk T C 10: 28,354,713 Y267H probably damaging Het
Pum2 A G 12: 8,744,654 I715V probably benign Het
R3hdm1 T C 1: 128,186,836 V518A probably damaging Het
Rab3d T C 9: 21,915,851 I28V probably damaging Het
Rad54b T C 4: 11,606,272 L560P probably damaging Het
Rgs20 A G 1: 5,070,147 probably null Het
Sesn1 T A 10: 41,905,319 L460H probably damaging Het
Slc39a14 A G 14: 70,316,436 probably null Het
Slco6c1 T A 1: 97,062,476 H663L probably benign Het
Snx13 T A 12: 35,082,927 C63S probably benign Het
Strip2 T C 6: 29,941,941 probably null Het
Syncrip A G 9: 88,479,567 probably benign Het
Taf15 A G 11: 83,504,753 probably benign Het
Tbc1d8 T C 1: 39,405,287 probably null Het
Tgm4 T A 9: 123,048,549 C205* probably null Het
Tmem212 A T 3: 27,886,479 L63Q possibly damaging Het
Tmem63a G A 1: 180,962,489 probably null Het
Trpm5 C A 7: 143,082,561 V525L probably benign Het
Ttn T C 2: 76,864,275 probably benign Het
Ttn A G 2: 76,706,827 L34919P probably damaging Het
Tuba4a T C 1: 75,217,425 I4V possibly damaging Het
Ubr4 A G 4: 139,473,542 D4679G possibly damaging Het
Usp2 T G 9: 44,092,148 V448G probably damaging Het
Usp3 A G 9: 66,545,742 probably null Het
Zfp341 T A 2: 154,628,801 V246E probably damaging Het
Other mutations in Dnah5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dnah5 APN 15 28272342 missense probably benign
IGL00331:Dnah5 APN 15 28421620 missense probably damaging 1.00
IGL00519:Dnah5 APN 15 28444218 missense probably benign 0.10
IGL00537:Dnah5 APN 15 28458702 critical splice donor site probably null
IGL01102:Dnah5 APN 15 28410003 critical splice donor site probably null
IGL01126:Dnah5 APN 15 28302399 missense possibly damaging 0.85
IGL01154:Dnah5 APN 15 28458656 missense possibly damaging 0.75
IGL01349:Dnah5 APN 15 28294913 splice site probably benign
IGL01353:Dnah5 APN 15 28233272 missense probably benign 0.00
IGL01372:Dnah5 APN 15 28230490 missense probably benign 0.00
IGL01390:Dnah5 APN 15 28411540 missense probably benign 0.00
IGL01446:Dnah5 APN 15 28326669 missense probably damaging 1.00
IGL01472:Dnah5 APN 15 28331726 missense probably damaging 1.00
IGL01485:Dnah5 APN 15 28331726 missense probably damaging 1.00
IGL01568:Dnah5 APN 15 28229652 missense probably benign 0.01
IGL01592:Dnah5 APN 15 28236637 missense probably benign 0.01
IGL01594:Dnah5 APN 15 28311334 missense possibly damaging 0.87
IGL01677:Dnah5 APN 15 28367782 missense probably damaging 1.00
IGL01845:Dnah5 APN 15 28449169 missense probably benign 0.06
IGL01904:Dnah5 APN 15 28307364 missense probably benign 0.09
IGL01913:Dnah5 APN 15 28313753 missense possibly damaging 0.50
IGL01950:Dnah5 APN 15 28290289 missense probably null 1.00
IGL01963:Dnah5 APN 15 28370536 missense probably benign 0.12
IGL02008:Dnah5 APN 15 28343552 missense probably damaging 0.98
IGL02088:Dnah5 APN 15 28459118 critical splice acceptor site probably null
IGL02090:Dnah5 APN 15 28240041 splice site probably benign
IGL02114:Dnah5 APN 15 28397124 missense probably damaging 0.97
IGL02135:Dnah5 APN 15 28247885 missense possibly damaging 0.50
IGL02232:Dnah5 APN 15 28299240 missense probably damaging 1.00
IGL02386:Dnah5 APN 15 28340381 missense probably damaging 1.00
IGL02475:Dnah5 APN 15 28219150 missense probably benign 0.09
IGL02626:Dnah5 APN 15 28307276 missense possibly damaging 0.94
IGL02650:Dnah5 APN 15 28289047 splice site probably benign
IGL02651:Dnah5 APN 15 28350622 missense probably benign 0.05
IGL02652:Dnah5 APN 15 28366187 missense probably damaging 0.99
IGL02670:Dnah5 APN 15 28409296 missense probably damaging 1.00
IGL02697:Dnah5 APN 15 28445143 missense probably benign 0.00
IGL02721:Dnah5 APN 15 28234243 critical splice acceptor site probably null
IGL02858:Dnah5 APN 15 28453212 missense possibly damaging 0.65
IGL02859:Dnah5 APN 15 28383625 missense probably benign 0.01
IGL02945:Dnah5 APN 15 28270426 missense probably benign 0.00
IGL02949:Dnah5 APN 15 28272185 missense probably benign 0.32
IGL02971:Dnah5 APN 15 28384461 missense probably damaging 1.00
IGL03017:Dnah5 APN 15 28340325 missense possibly damaging 0.93
IGL03177:Dnah5 APN 15 28295399 missense probably damaging 0.97
IGL03212:Dnah5 APN 15 28290163 missense probably benign 0.08
IGL03224:Dnah5 APN 15 28459154 missense probably damaging 1.00
IGL03231:Dnah5 APN 15 28311148 missense probably damaging 1.00
IGL03273:Dnah5 APN 15 28458649 missense probably damaging 0.98
IGL03294:Dnah5 APN 15 28233295 critical splice donor site probably null
IGL03331:Dnah5 APN 15 28419940 missense probably damaging 1.00
IGL03337:Dnah5 APN 15 28290141 missense probably benign 0.10
IGL03367:Dnah5 APN 15 28234327 missense possibly damaging 0.95
Firtel UTSW 15 28448367 missense possibly damaging 0.95
lowbar UTSW 15 28311133 splice site probably null
notherone UTSW 15 28340406 missense probably benign 0.13
scheffler UTSW 15 28438091 splice site probably benign
IGL02837:Dnah5 UTSW 15 28269400 missense probably benign
P0008:Dnah5 UTSW 15 28302387 missense probably damaging 1.00
P0014:Dnah5 UTSW 15 28403473 missense probably damaging 1.00
PIT4687001:Dnah5 UTSW 15 28383577 missense probably damaging 0.98
R0030:Dnah5 UTSW 15 28451517 missense probably benign 0.34
R0087:Dnah5 UTSW 15 28350613 missense probably damaging 1.00
R0099:Dnah5 UTSW 15 28239934 missense probably damaging 1.00
R0102:Dnah5 UTSW 15 28245751 splice site probably benign
R0102:Dnah5 UTSW 15 28245751 splice site probably benign
R0104:Dnah5 UTSW 15 28453353 missense possibly damaging 0.88
R0112:Dnah5 UTSW 15 28263679 missense probably benign 0.00
R0122:Dnah5 UTSW 15 28378363 missense probably damaging 1.00
R0126:Dnah5 UTSW 15 28246319 missense probably benign 0.00
R0127:Dnah5 UTSW 15 28294925 missense probably damaging 1.00
R0233:Dnah5 UTSW 15 28333070 missense probably damaging 1.00
R0310:Dnah5 UTSW 15 28299110 missense probably benign 0.19
R0386:Dnah5 UTSW 15 28383581 missense probably damaging 1.00
R0421:Dnah5 UTSW 15 28229541 missense possibly damaging 0.79
R0481:Dnah5 UTSW 15 28383599 missense probably benign 0.31
R0514:Dnah5 UTSW 15 28366321 missense probably damaging 1.00
R0609:Dnah5 UTSW 15 28327779 missense probably benign
R0720:Dnah5 UTSW 15 28313861 missense probably null 0.98
R0731:Dnah5 UTSW 15 28311143 missense possibly damaging 0.78
R0747:Dnah5 UTSW 15 28444186 missense probably damaging 0.99
R0747:Dnah5 UTSW 15 28444187 missense possibly damaging 0.64
R0766:Dnah5 UTSW 15 28448487 missense probably null 0.89
R0849:Dnah5 UTSW 15 28263599 missense probably damaging 0.96
R1034:Dnah5 UTSW 15 28302471 missense probably damaging 1.00
R1084:Dnah5 UTSW 15 28343452 missense probably benign 0.01
R1148:Dnah5 UTSW 15 28421690 missense probably damaging 1.00
R1148:Dnah5 UTSW 15 28421690 missense probably damaging 1.00
R1200:Dnah5 UTSW 15 28246257 missense possibly damaging 0.88
R1208:Dnah5 UTSW 15 28327731 missense probably damaging 1.00
R1208:Dnah5 UTSW 15 28327731 missense probably damaging 1.00
R1269:Dnah5 UTSW 15 28238511 missense probably damaging 1.00
R1373:Dnah5 UTSW 15 28313918 splice site probably benign
R1401:Dnah5 UTSW 15 28401913 missense probably damaging 1.00
R1413:Dnah5 UTSW 15 28370409 missense probably benign
R1430:Dnah5 UTSW 15 28345857 missense probably benign 0.37
R1457:Dnah5 UTSW 15 28403542 critical splice donor site probably null
R1468:Dnah5 UTSW 15 28230463 nonsense probably null
R1468:Dnah5 UTSW 15 28230463 nonsense probably null
R1560:Dnah5 UTSW 15 28420003 missense probably damaging 1.00
R1568:Dnah5 UTSW 15 28409177 missense probably damaging 0.98
R1574:Dnah5 UTSW 15 28252423 missense probably benign 0.00
R1574:Dnah5 UTSW 15 28252423 missense probably benign 0.00
R1603:Dnah5 UTSW 15 28294985 splice site probably benign
R1603:Dnah5 UTSW 15 28449180 missense probably benign 0.09
R1673:Dnah5 UTSW 15 28290148 missense probably benign
R1755:Dnah5 UTSW 15 28326636 missense probably damaging 0.99
R1785:Dnah5 UTSW 15 28313786 missense probably damaging 1.00
R1786:Dnah5 UTSW 15 28313786 missense probably damaging 1.00
R1789:Dnah5 UTSW 15 28270426 missense probably benign 0.00
R1817:Dnah5 UTSW 15 28246400 nonsense probably null
R1819:Dnah5 UTSW 15 28246400 nonsense probably null
R1834:Dnah5 UTSW 15 28409124 missense probably benign 0.00
R1855:Dnah5 UTSW 15 28411669 missense possibly damaging 0.88
R1870:Dnah5 UTSW 15 28331713 nonsense probably null
R1871:Dnah5 UTSW 15 28331713 nonsense probably null
R1987:Dnah5 UTSW 15 28343591 missense probably damaging 0.99
R1988:Dnah5 UTSW 15 28343591 missense probably damaging 0.99
R1989:Dnah5 UTSW 15 28343591 missense probably damaging 0.99
R2062:Dnah5 UTSW 15 28366270 missense probably damaging 1.00
R2069:Dnah5 UTSW 15 28312388 splice site probably null
R2121:Dnah5 UTSW 15 28297005 splice site probably benign
R2128:Dnah5 UTSW 15 28408321 missense probably benign 0.00
R2129:Dnah5 UTSW 15 28408321 missense probably benign 0.00
R2151:Dnah5 UTSW 15 28444091 missense probably damaging 1.00
R2159:Dnah5 UTSW 15 28252545 missense probably benign 0.00
R2207:Dnah5 UTSW 15 28343671 missense probably benign 0.11
R2231:Dnah5 UTSW 15 28408417 critical splice donor site probably null
R2232:Dnah5 UTSW 15 28408417 critical splice donor site probably null
R2282:Dnah5 UTSW 15 28327302 missense probably damaging 0.99
R2305:Dnah5 UTSW 15 28387767 missense probably benign 0.25
R2339:Dnah5 UTSW 15 28313882 missense probably benign 0.00
R2696:Dnah5 UTSW 15 28278576 missense probably benign 0.00
R3156:Dnah5 UTSW 15 28438091 splice site probably benign
R3431:Dnah5 UTSW 15 28295267 missense probably benign 0.20
R3700:Dnah5 UTSW 15 28387791 missense possibly damaging 0.72
R3724:Dnah5 UTSW 15 28270420 missense probably benign 0.08
R3732:Dnah5 UTSW 15 28409122 missense possibly damaging 0.64
R3872:Dnah5 UTSW 15 28411510 missense possibly damaging 0.50
R4063:Dnah5 UTSW 15 28420998 missense probably damaging 0.98
R4072:Dnah5 UTSW 15 28340298 nonsense probably null
R4075:Dnah5 UTSW 15 28293791 missense probably benign
R4245:Dnah5 UTSW 15 28219189 missense probably benign
R4254:Dnah5 UTSW 15 28438102 missense probably benign 0.07
R4255:Dnah5 UTSW 15 28438102 missense probably benign 0.07
R4392:Dnah5 UTSW 15 28289229 missense probably benign 0.19
R4552:Dnah5 UTSW 15 28397154 missense probably benign 0.19
R4574:Dnah5 UTSW 15 28367763 missense probably benign 0.05
R4577:Dnah5 UTSW 15 28289250 missense probably benign 0.06
R4587:Dnah5 UTSW 15 28304599 missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28401953 missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28419994 missense probably damaging 1.00
R4676:Dnah5 UTSW 15 28295260 missense possibly damaging 0.65
R4707:Dnah5 UTSW 15 28372375 missense probably damaging 0.97
R4754:Dnah5 UTSW 15 28420955 splice site probably null
R4767:Dnah5 UTSW 15 28270474 missense probably benign 0.02
R4857:Dnah5 UTSW 15 28345807 missense probably benign 0.00
R4883:Dnah5 UTSW 15 28343638 missense probably benign 0.00
R4889:Dnah5 UTSW 15 28235792 missense probably benign 0.01
R4946:Dnah5 UTSW 15 28326557 missense probably damaging 0.96
R4946:Dnah5 UTSW 15 28387904 missense probably damaging 1.00
R4947:Dnah5 UTSW 15 28272372 missense probably benign
R5033:Dnah5 UTSW 15 28421678 missense probably damaging 0.96
R5164:Dnah5 UTSW 15 28408292 missense probably benign 0.00
R5175:Dnah5 UTSW 15 28448404 missense probably damaging 1.00
R5182:Dnah5 UTSW 15 28311278 missense probably damaging 0.99
R5187:Dnah5 UTSW 15 28272172 missense probably benign 0.41
R5272:Dnah5 UTSW 15 28350665 missense probably benign
R5308:Dnah5 UTSW 15 28229651 missense possibly damaging 0.80
R5310:Dnah5 UTSW 15 28311328 missense probably damaging 1.00
R5322:Dnah5 UTSW 15 28384244 missense probably benign 0.41
R5398:Dnah5 UTSW 15 28293726 missense probably benign
R5596:Dnah5 UTSW 15 28343608 missense probably damaging 1.00
R5603:Dnah5 UTSW 15 28419932 missense probably damaging 1.00
R5619:Dnah5 UTSW 15 28302435 missense probably damaging 1.00
R5656:Dnah5 UTSW 15 28421064 missense probably benign 0.03
R5741:Dnah5 UTSW 15 28246367 missense probably benign 0.11
R5754:Dnah5 UTSW 15 28401868 missense probably benign 0.01
R5763:Dnah5 UTSW 15 28311152 missense probably damaging 1.00
R5824:Dnah5 UTSW 15 28313821 missense probably benign 0.00
R5836:Dnah5 UTSW 15 28383592 missense probably damaging 1.00
R5838:Dnah5 UTSW 15 28290195 missense probably benign 0.00
R5864:Dnah5 UTSW 15 28297013 missense possibly damaging 0.83
R5895:Dnah5 UTSW 15 28234453 splice site probably null
R5896:Dnah5 UTSW 15 28272060 missense probably benign
R5899:Dnah5 UTSW 15 28448367 missense possibly damaging 0.95
R5905:Dnah5 UTSW 15 28387833 missense probably damaging 1.00
R5924:Dnah5 UTSW 15 28307327 missense probably benign 0.41
R5927:Dnah5 UTSW 15 28335718 missense probably benign 0.00
R5929:Dnah5 UTSW 15 28311207 missense probably benign 0.01
R5929:Dnah5 UTSW 15 28311208 missense probably damaging 1.00
R5931:Dnah5 UTSW 15 28453279 missense probably damaging 0.99
R5964:Dnah5 UTSW 15 28458584 missense possibly damaging 0.49
R5975:Dnah5 UTSW 15 28234282 missense probably damaging 1.00
R5993:Dnah5 UTSW 15 28299226 missense probably benign 0.09
R6016:Dnah5 UTSW 15 28327884 missense probably damaging 1.00
R6028:Dnah5 UTSW 15 28387833 missense probably damaging 1.00
R6065:Dnah5 UTSW 15 28230468 missense possibly damaging 0.47
R6117:Dnah5 UTSW 15 28270420 missense probably damaging 0.99
R6143:Dnah5 UTSW 15 28233231 missense probably benign 0.05
R6146:Dnah5 UTSW 15 28459185 missense probably benign
R6154:Dnah5 UTSW 15 28204031 missense probably benign 0.15
R6164:Dnah5 UTSW 15 28378343 missense probably benign 0.08
R6266:Dnah5 UTSW 15 28335627 missense possibly damaging 0.67
R6321:Dnah5 UTSW 15 28372411 missense probably damaging 0.99
R6349:Dnah5 UTSW 15 28238511 missense probably damaging 1.00
R6431:Dnah5 UTSW 15 28349824 missense possibly damaging 0.52
R6467:Dnah5 UTSW 15 28438183 missense probably benign 0.10
R6564:Dnah5 UTSW 15 28367745 missense probably benign
R6607:Dnah5 UTSW 15 28445200 missense possibly damaging 0.95
R6619:Dnah5 UTSW 15 28409120 missense probably benign 0.03
R6633:Dnah5 UTSW 15 28293787 missense probably benign 0.27
R6647:Dnah5 UTSW 15 28403487 missense probably benign 0.02
R6782:Dnah5 UTSW 15 28449156 missense possibly damaging 0.89
R6797:Dnah5 UTSW 15 28233238 nonsense probably null
R6797:Dnah5 UTSW 15 28451463 missense probably damaging 1.00
R6831:Dnah5 UTSW 15 28411515 missense possibly damaging 0.88
R6849:Dnah5 UTSW 15 28278624 missense probably benign 0.14
R6871:Dnah5 UTSW 15 28229640 missense probably benign 0.32
R6936:Dnah5 UTSW 15 28409268 missense probably damaging 1.00
R6943:Dnah5 UTSW 15 28235720 missense probably damaging 1.00
R7030:Dnah5 UTSW 15 28238592 missense probably benign
R7030:Dnah5 UTSW 15 28333062 missense probably benign 0.00
R7032:Dnah5 UTSW 15 28326650 missense probably damaging 1.00
R7063:Dnah5 UTSW 15 28233248 missense probably benign 0.00
R7094:Dnah5 UTSW 15 28453336 missense probably damaging 0.98
R7097:Dnah5 UTSW 15 28453264 missense probably benign 0.00
R7126:Dnah5 UTSW 15 28349837 missense probably benign 0.03
R7153:Dnah5 UTSW 15 28365522 splice site probably null
R7209:Dnah5 UTSW 15 28459225 missense possibly damaging 0.71
R7276:Dnah5 UTSW 15 28367838 missense probably damaging 1.00
R7320:Dnah5 UTSW 15 28270470 missense probably null 0.33
R7350:Dnah5 UTSW 15 28235819 critical splice donor site probably null
R7380:Dnah5 UTSW 15 28370378 missense probably damaging 1.00
R7438:Dnah5 UTSW 15 28346952 missense probably damaging 0.99
R7499:Dnah5 UTSW 15 28302450 missense probably damaging 1.00
R7513:Dnah5 UTSW 15 28370415 missense probably benign
R7519:Dnah5 UTSW 15 28390483 missense probably damaging 0.98
R7524:Dnah5 UTSW 15 28297066 missense possibly damaging 0.50
R7556:Dnah5 UTSW 15 28290243 missense probably null 0.43
R7570:Dnah5 UTSW 15 28346952 missense probably damaging 1.00
R7585:Dnah5 UTSW 15 28401868 missense probably benign 0.09
R7642:Dnah5 UTSW 15 28247979 critical splice donor site probably null
R7670:Dnah5 UTSW 15 28246232 splice site probably null
R7763:Dnah5 UTSW 15 28313855 missense probably damaging 1.00
R7821:Dnah5 UTSW 15 28411532 missense possibly damaging 0.89
R7826:Dnah5 UTSW 15 28367812 missense probably damaging 1.00
R7872:Dnah5 UTSW 15 28245684 missense probably damaging 0.99
R7889:Dnah5 UTSW 15 28448414 nonsense probably null
R7919:Dnah5 UTSW 15 28350596 missense probably damaging 1.00
R7920:Dnah5 UTSW 15 28453222 missense probably benign 0.00
R7936:Dnah5 UTSW 15 28345837 missense possibly damaging 0.64
R7996:Dnah5 UTSW 15 28409177 missense probably damaging 0.98
R8063:Dnah5 UTSW 15 28230583 missense probably benign
R8084:Dnah5 UTSW 15 28387953 missense probably damaging 1.00
R8105:Dnah5 UTSW 15 28372402 missense probably benign
R8114:Dnah5 UTSW 15 28239976 missense probably benign 0.01
R8142:Dnah5 UTSW 15 28384373 missense probably benign 0.36
R8153:Dnah5 UTSW 15 28384430 missense probably damaging 1.00
R8161:Dnah5 UTSW 15 28350704 missense possibly damaging 0.79
R8174:Dnah5 UTSW 15 28311133 splice site probably null
R8187:Dnah5 UTSW 15 28384209 missense probably damaging 1.00
R8194:Dnah5 UTSW 15 28453268 missense probably damaging 0.99
R8280:Dnah5 UTSW 15 28408392 missense probably benign 0.01
R8291:Dnah5 UTSW 15 28263597 missense probably benign 0.03
R8324:Dnah5 UTSW 15 28346865 missense probably damaging 1.00
R8347:Dnah5 UTSW 15 28236666 missense possibly damaging 0.90
R8356:Dnah5 UTSW 15 28444167 missense probably benign 0.03
R8356:Dnah5 UTSW 15 28444323 missense probably null 0.02
R8361:Dnah5 UTSW 15 28331810 missense probably damaging 0.98
R8375:Dnah5 UTSW 15 28327343 missense probably benign 0.00
R8474:Dnah5 UTSW 15 28247832 missense probably benign 0.00
R8481:Dnah5 UTSW 15 28419795 missense probably benign 0.00
R8494:Dnah5 UTSW 15 28345831 missense probably benign 0.32
R8495:Dnah5 UTSW 15 28409268 missense probably damaging 0.97
R8519:Dnah5 UTSW 15 28299099 missense probably benign 0.07
R8683:Dnah5 UTSW 15 28289221 missense probably benign 0.00
R8739:Dnah5 UTSW 15 28345860 missense probably benign 0.01
R8752:Dnah5 UTSW 15 28290219 missense probably benign 0.00
R8784:Dnah5 UTSW 15 28387951 missense probably benign 0.16
R8813:Dnah5 UTSW 15 28229573 missense probably damaging 1.00
R8862:Dnah5 UTSW 15 28459356 splice site probably benign
R8873:Dnah5 UTSW 15 28219188 missense probably benign
R8885:Dnah5 UTSW 15 28327740 missense probably damaging 1.00
R8901:Dnah5 UTSW 15 28365569 missense possibly damaging 0.76
R9025:Dnah5 UTSW 15 28409266 missense probably damaging 1.00
R9037:Dnah5 UTSW 15 28247958 missense probably benign 0.05
R9057:Dnah5 UTSW 15 28390868 missense probably damaging 1.00
R9059:Dnah5 UTSW 15 28245666 missense probably benign
R9065:Dnah5 UTSW 15 28293790 missense probably benign 0.09
R9098:Dnah5 UTSW 15 28419961 missense
R9118:Dnah5 UTSW 15 28401848 frame shift probably null
R9149:Dnah5 UTSW 15 28387768 missense probably benign 0.00
R9184:Dnah5 UTSW 15 28340406 missense probably benign 0.13
R9205:Dnah5 UTSW 15 28448334 missense possibly damaging 0.88
R9297:Dnah5 UTSW 15 28203908 start gained probably benign
R9302:Dnah5 UTSW 15 28239886 missense probably benign 0.03
R9310:Dnah5 UTSW 15 28448433 missense probably damaging 1.00
R9318:Dnah5 UTSW 15 28203908 start gained probably benign
R9405:Dnah5 UTSW 15 28272160 missense probably benign
R9424:Dnah5 UTSW 15 28272140 missense probably benign 0.01
R9467:Dnah5 UTSW 15 28366147 missense possibly damaging 0.94
R9469:Dnah5 UTSW 15 28421000 missense probably benign 0.06
R9548:Dnah5 UTSW 15 28327879 missense possibly damaging 0.79
R9564:Dnah5 UTSW 15 28290276 missense probably benign 0.04
R9576:Dnah5 UTSW 15 28272140 missense probably benign 0.01
R9593:Dnah5 UTSW 15 28236628 missense probably benign
R9644:Dnah5 UTSW 15 28230504 missense probably damaging 0.98
R9655:Dnah5 UTSW 15 28242754 missense probably benign
R9657:Dnah5 UTSW 15 28409943 missense probably damaging 1.00
R9704:Dnah5 UTSW 15 28247819 missense probably benign 0.00
R9797:Dnah5 UTSW 15 28233170 missense probably benign 0.34
RF009:Dnah5 UTSW 15 28204019 missense probably benign 0.00
X0011:Dnah5 UTSW 15 28408381 missense probably benign 0.16
X0018:Dnah5 UTSW 15 28269354 missense probably benign 0.00
X0022:Dnah5 UTSW 15 28270411 missense probably benign 0.01
X0023:Dnah5 UTSW 15 28384308 missense probably damaging 0.99
X0028:Dnah5 UTSW 15 28470477 missense probably damaging 1.00
Z1088:Dnah5 UTSW 15 28366357 missense probably null 0.10
Z1088:Dnah5 UTSW 15 28384230 missense probably damaging 1.00
Z1177:Dnah5 UTSW 15 28270354 missense probably benign 0.32
Z1177:Dnah5 UTSW 15 28270403 missense probably benign 0.00
Z1177:Dnah5 UTSW 15 28295311 missense probably damaging 0.98
Z1177:Dnah5 UTSW 15 28387763 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TCCTCCCTGCAGATACTTGG -3'
(R):5'- CTCCATCGAATTGGATAATACACAC -3'

Sequencing Primer
(F):5'- CTCCCTGCAGATACTTGGAGAAG -3'
(R):5'- TATGGTATAGTCCAGGCAAGCCTC -3'
Posted On 2014-11-12