Incidental Mutation 'R2437:Carns1'
ID249687
Institutional Source Beutler Lab
Gene Symbol Carns1
Ensembl Gene ENSMUSG00000075289
Gene Namecarnosine synthase 1
SynonymsAtpgd1
MMRRC Submission 040398-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R2437 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4164324-4175479 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4165783 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 800 (M800K)
Ref Sequence ENSEMBL: ENSMUSP00000131624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025749] [ENSMUST00000118483] [ENSMUST00000127605] [ENSMUST00000130469] [ENSMUST00000137431] [ENSMUST00000167055]
Predicted Effect probably benign
Transcript: ENSMUST00000025749
SMART Domains Protein: ENSMUSP00000025749
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
S_TKc 67 328 2.56e-103 SMART
S_TK_X 329 391 2.6e-26 SMART
low complexity region 406 421 N/A INTRINSIC
low complexity region 428 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118483
SMART Domains Protein: ENSMUSP00000112512
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
S_TKc 67 328 2.56e-103 SMART
S_TK_X 329 384 1.69e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125057
Predicted Effect probably benign
Transcript: ENSMUST00000127605
SMART Domains Protein: ENSMUSP00000123376
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
S_TKc 67 304 1.6e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130469
SMART Domains Protein: ENSMUSP00000117446
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:Pkinase 67 153 2.7e-14 PFAM
Pfam:Pkinase_Tyr 67 153 9.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135911
Predicted Effect probably benign
Transcript: ENSMUST00000137431
SMART Domains Protein: ENSMUSP00000116744
Gene: ENSMUSG00000024830

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:Pkinase_Tyr 67 277 4.6e-31 PFAM
Pfam:Pkinase 67 278 2.2e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155303
Predicted Effect possibly damaging
Transcript: ENSMUST00000167055
AA Change: M800K

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131624
Gene: ENSMUSG00000075289
AA Change: M800K

DomainStartEndE-ValueType
low complexity region 206 217 N/A INTRINSIC
low complexity region 312 328 N/A INTRINSIC
low complexity region 332 348 N/A INTRINSIC
low complexity region 399 410 N/A INTRINSIC
low complexity region 414 433 N/A INTRINSIC
low complexity region 490 496 N/A INTRINSIC
Pfam:ATP-grasp_4 620 819 4.1e-46 PFAM
low complexity region 862 875 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181211
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CARNS1 (EC 6.3.2.11), a member of the ATP-grasp family of ATPases, catalyzes the formation of carnosine (beta-alanyl-L-histidine) and homocarnosine (gamma-aminobutyryl-L-histidine), which are found mainly in skeletal muscle and the central nervous system, respectively (Drozak et al., 2010 [PubMed 20097752]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,946,618 *635W probably null Het
4921507P07Rik T A 6: 50,583,979 D212V probably damaging Het
4932438A13Rik T A 3: 36,958,685 probably null Het
Anxa2 A G 9: 69,489,764 Y317C probably damaging Het
Arhgef26 T C 3: 62,432,581 S675P probably damaging Het
Camk2d A G 3: 126,834,628 N53S probably damaging Het
Ces1f A T 8: 93,270,139 probably null Het
Chrne T A 11: 70,615,260 D426V possibly damaging Het
Cntfr T C 4: 41,671,035 T43A probably damaging Het
Cntn5 A T 9: 10,048,753 C63* probably null Het
Col12a1 G A 9: 79,692,219 T884I probably damaging Het
Dnah5 T C 15: 28,307,391 probably null Het
Dnajc2 A T 5: 21,760,391 S537R probably benign Het
Dnajc25 T C 4: 59,020,234 I100T probably damaging Het
Ephx1 C A 1: 180,996,096 G149C probably damaging Het
Fam163b G T 2: 27,112,686 P100T probably damaging Het
Fgd5 A T 6: 92,062,869 R1017* probably null Het
Fibin A T 2: 110,362,503 L98Q probably damaging Het
Fndc3b A T 3: 27,451,332 L929H probably damaging Het
Frem1 T A 4: 83,000,173 S512C probably damaging Het
Gm4922 T A 10: 18,784,081 M298L probably benign Het
Gstm2 G A 3: 107,984,053 probably benign Het
Gtf3c2 A G 5: 31,159,698 probably null Het
Ibtk A C 9: 85,708,125 L1026V probably benign Het
Il9 T A 13: 56,481,871 probably benign Het
Inpp4a T C 1: 37,392,956 S146P probably damaging Het
Kcnab1 G T 3: 65,357,014 probably benign Het
Lrrc29 A G 8: 105,313,043 probably null Het
Mgat4c T C 10: 102,388,575 S217P probably damaging Het
Mr1 T C 1: 155,132,531 M233V probably benign Het
Ncoa2 G A 1: 13,148,360 T1415I probably damaging Het
Oasl2 G A 5: 114,911,296 D486N probably benign Het
Olfr1412 T C 1: 92,588,966 I212T possibly damaging Het
Olfr342 A T 2: 36,528,246 Y278F probably damaging Het
Olfr461 G A 6: 40,544,922 T19I probably benign Het
Pcnx4 T C 12: 72,541,813 F132L probably damaging Het
Pde5a T A 3: 122,843,053 L717Q probably damaging Het
Peli2 A T 14: 48,227,932 probably benign Het
Phf14 A G 6: 11,962,658 S435G probably damaging Het
Plekhg1 T A 10: 3,963,564 H1095Q probably damaging Het
Plekhh2 A G 17: 84,586,479 probably null Het
Plekho1 T G 3: 95,992,185 N99H probably damaging Het
Plxnc1 T A 10: 94,906,533 K457N probably benign Het
Ppp1r3a T C 6: 14,718,323 E864G probably benign Het
Prkab2 T A 3: 97,667,399 L237Q probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptger3 T A 3: 157,567,570 C185S probably damaging Het
Ptprk T C 10: 28,354,713 Y267H probably damaging Het
Pum2 A G 12: 8,744,654 I715V probably benign Het
R3hdm1 T C 1: 128,186,836 V518A probably damaging Het
Rab3d T C 9: 21,915,851 I28V probably damaging Het
Rad54b T C 4: 11,606,272 L560P probably damaging Het
Rgs20 A G 1: 5,070,147 probably null Het
Sesn1 T A 10: 41,905,319 L460H probably damaging Het
Slc39a14 A G 14: 70,316,436 probably null Het
Slco6c1 T A 1: 97,062,476 H663L probably benign Het
Snx13 T A 12: 35,082,927 C63S probably benign Het
Strip2 T C 6: 29,941,941 probably null Het
Syncrip A G 9: 88,479,567 probably benign Het
Taf15 A G 11: 83,504,753 probably benign Het
Tbc1d8 T C 1: 39,405,287 probably null Het
Tgm4 T A 9: 123,048,549 C205* probably null Het
Tmem212 A T 3: 27,886,479 L63Q possibly damaging Het
Tmem63a G A 1: 180,962,489 probably null Het
Trpm5 C A 7: 143,082,561 V525L probably benign Het
Ttn A G 2: 76,706,827 L34919P probably damaging Het
Ttn T C 2: 76,864,275 probably benign Het
Tuba4a T C 1: 75,217,425 I4V possibly damaging Het
Ubr4 A G 4: 139,473,542 D4679G possibly damaging Het
Usp2 T G 9: 44,092,148 V448G probably damaging Het
Usp3 A G 9: 66,545,742 probably null Het
Zfp341 T A 2: 154,628,801 V246E probably damaging Het
Other mutations in Carns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Carns1 APN 19 4166499 splice site probably null
IGL02246:Carns1 APN 19 4166432 missense possibly damaging 0.87
IGL02658:Carns1 APN 19 4173084 missense probably benign 0.01
IGL02800:Carns1 APN 19 4166570 splice site probably benign
R1750:Carns1 UTSW 19 4173157 missense possibly damaging 0.63
R1902:Carns1 UTSW 19 4166338 missense probably damaging 1.00
R1935:Carns1 UTSW 19 4165474 missense probably damaging 1.00
R2434:Carns1 UTSW 19 4165449 missense probably damaging 1.00
R3772:Carns1 UTSW 19 4170916 splice site probably benign
R4091:Carns1 UTSW 19 4171683 missense probably damaging 0.96
R4518:Carns1 UTSW 19 4170070 missense probably benign 0.05
R4668:Carns1 UTSW 19 4165476 nonsense probably null
R4737:Carns1 UTSW 19 4170928 intron probably benign
R4751:Carns1 UTSW 19 4166418 missense probably damaging 1.00
R5384:Carns1 UTSW 19 4171901 critical splice acceptor site probably null
R6077:Carns1 UTSW 19 4170876 missense probably benign 0.01
R6373:Carns1 UTSW 19 4166516 missense probably benign 0.41
R6411:Carns1 UTSW 19 4166464 missense probably damaging 1.00
R6470:Carns1 UTSW 19 4171783 missense possibly damaging 0.85
R6486:Carns1 UTSW 19 4169980 missense probably benign 0.04
R6915:Carns1 UTSW 19 4169913 missense probably benign 0.34
R6981:Carns1 UTSW 19 4170082 missense probably benign 0.00
R7936:Carns1 UTSW 19 4166153 missense probably benign
R8025:Carns1 UTSW 19 4166506 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTTTGCAGAGTCTCTCTAC -3'
(R):5'- TTCGTCTCCGATAATGGCCC -3'

Sequencing Primer
(F):5'- CATGATGCCCACTAGGTAGC -3'
(R):5'- TCCGATAATGGCCCCACAAGG -3'
Posted On2014-11-12