Incidental Mutation 'R2438:Defb21'
ID249695
Institutional Source Beutler Lab
Gene Symbol Defb21
Ensembl Gene ENSMUSG00000056544
Gene Namedefensin beta 21
SynonymsLOC228782, 4930525K10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R2438 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location152572744-152574944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 152574775 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 57 (Y57F)
Ref Sequence ENSEMBL: ENSMUSP00000065102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053180] [ENSMUST00000070722]
Predicted Effect probably benign
Transcript: ENSMUST00000053180
SMART Domains Protein: ENSMUSP00000059585
Gene: ENSMUSG00000050645

DomainStartEndE-ValueType
Pfam:Defensin_big 2 60 3.4e-9 PFAM
Pfam:Defensin_beta_2 26 55 5.1e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000070722
AA Change: Y57F

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000065102
Gene: ENSMUSG00000056544
AA Change: Y57F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Defensin_beta_2 33 62 1.4e-9 PFAM
low complexity region 76 86 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik T C 9: 22,431,683 V291A probably damaging Het
Acap2 A G 16: 31,117,315 V318A probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd8b1 A G 6: 71,329,756 K156E probably damaging Het
Ckap5 T C 2: 91,595,408 M1262T possibly damaging Het
Crebbp A G 16: 4,154,858 M324T possibly damaging Het
Cwf19l1 G A 19: 44,110,563 R523C probably benign Het
Ebf2 T A 14: 67,387,942 V233D probably damaging Het
Gfpt1 A T 6: 87,057,745 E175V probably null Het
Gga1 T C 15: 78,885,298 F157S probably damaging Het
Impdh2 A T 9: 108,560,616 D28V probably benign Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Krt5 T C 15: 101,711,658 N208S probably benign Het
Myo15 A T 11: 60,483,052 I1242F probably damaging Het
Myo1g A T 11: 6,511,542 N636K probably damaging Het
Nrros T C 16: 32,144,111 probably null Het
Nrros C T 16: 32,144,299 G264D probably benign Het
Nsun4 A G 4: 116,048,597 V54A probably benign Het
Olfr1299 A T 2: 111,664,751 D175V probably damaging Het
Olfr1458 A T 19: 13,102,421 D294E probably benign Het
Pilrb2 T A 5: 137,870,913 I142L probably benign Het
Ryr2 A G 13: 11,801,848 S596P probably damaging Het
Sema5a G T 15: 32,550,253 S146I possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc43a2 A T 11: 75,563,131 E290V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Zfp456 A T 13: 67,366,954 I211N probably damaging Het
Other mutations in Defb21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Defb21 APN 2 152574792 missense probably benign 0.33
IGL00795:Defb21 APN 2 152574745 missense probably benign 0.00
IGL01301:Defb21 APN 2 152574751 missense possibly damaging 0.85
IGL01686:Defb21 APN 2 152574901 unclassified probably benign
ANU18:Defb21 UTSW 2 152574751 missense possibly damaging 0.85
R2305:Defb21 UTSW 2 152574871 missense possibly damaging 0.96
R6805:Defb21 UTSW 2 152574869 missense probably benign 0.01
X0063:Defb21 UTSW 2 152573832 unclassified probably benign
Z1176:Defb21 UTSW 2 152573833 missense unknown
Predicted Primers PCR Primer
(F):5'- ATTATCAAACTGCAGCTAGGAGG -3'
(R):5'- AAACTTCAGGGACAGGGCTC -3'

Sequencing Primer
(F):5'- CTAAGGGCTGTGTCCTGC -3'
(R):5'- TCCAGCCACCTCTCAGG -3'
Posted On2014-11-12