Incidental Mutation 'R2438:Gfpt1'
ID249700
Institutional Source Beutler Lab
Gene Symbol Gfpt1
Ensembl Gene ENSMUSG00000029992
Gene Nameglutamine fructose-6-phosphate transaminase 1
SynonymsGFA, 2810423A18Rik, GFAT, GFAT1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2438 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location87042846-87092197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87057745 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 175 (E175V)
Ref Sequence ENSEMBL: ENSMUSP00000109288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032057] [ENSMUST00000113655] [ENSMUST00000113657] [ENSMUST00000113658]
Predicted Effect probably null
Transcript: ENSMUST00000032057
AA Change: E175V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032057
Gene: ENSMUSG00000029992
AA Change: E175V

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
Pfam:GATase_6 69 213 1e-18 PFAM
Pfam:GATase_4 78 198 2.7e-7 PFAM
Pfam:GATase_7 93 195 2.1e-14 PFAM
Pfam:SIS 378 507 4.5e-38 PFAM
Pfam:SIS 549 680 1.6e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113655
SMART Domains Protein: ENSMUSP00000109285
Gene: ENSMUSG00000029992

DomainStartEndE-ValueType
Pfam:GATase_2 2 65 7.8e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113657
SMART Domains Protein: ENSMUSP00000109287
Gene: ENSMUSG00000029992

DomainStartEndE-ValueType
Pfam:GATase_2 2 80 1.7e-10 PFAM
Pfam:GATase_2 76 120 9.5e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113658
AA Change: E175V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109288
Gene: ENSMUSG00000029992
AA Change: E175V

DomainStartEndE-ValueType
Pfam:GATase_2 2 78 9e-9 PFAM
Pfam:GATase_4 63 191 3.2e-10 PFAM
Pfam:GATase_6 68 211 3.7e-20 PFAM
Pfam:GATase_2 76 220 6.4e-22 PFAM
Pfam:GATase_7 93 194 1.7e-15 PFAM
Pfam:SIS 362 491 4.5e-36 PFAM
Pfam:SIS 533 664 2.3e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150410
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the first and rate-limiting enzyme of the hexosamine pathway and controls the flux of glucose into the hexosamine pathway. The product of this gene catalyzes the formation of glucosamine 6-phosphate. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik T C 9: 22,431,683 V291A probably damaging Het
Acap2 A G 16: 31,117,315 V318A probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd8b1 A G 6: 71,329,756 K156E probably damaging Het
Ckap5 T C 2: 91,595,408 M1262T possibly damaging Het
Crebbp A G 16: 4,154,858 M324T possibly damaging Het
Cwf19l1 G A 19: 44,110,563 R523C probably benign Het
Defb21 A T 2: 152,574,775 Y57F possibly damaging Het
Ebf2 T A 14: 67,387,942 V233D probably damaging Het
Gga1 T C 15: 78,885,298 F157S probably damaging Het
Impdh2 A T 9: 108,560,616 D28V probably benign Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Krt5 T C 15: 101,711,658 N208S probably benign Het
Myo15 A T 11: 60,483,052 I1242F probably damaging Het
Myo1g A T 11: 6,511,542 N636K probably damaging Het
Nrros T C 16: 32,144,111 probably null Het
Nrros C T 16: 32,144,299 G264D probably benign Het
Nsun4 A G 4: 116,048,597 V54A probably benign Het
Olfr1299 A T 2: 111,664,751 D175V probably damaging Het
Olfr1458 A T 19: 13,102,421 D294E probably benign Het
Pilrb2 T A 5: 137,870,913 I142L probably benign Het
Ryr2 A G 13: 11,801,848 S596P probably damaging Het
Sema5a G T 15: 32,550,253 S146I possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc43a2 A T 11: 75,563,131 E290V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Zfp456 A T 13: 67,366,954 I211N probably damaging Het
Other mutations in Gfpt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Gfpt1 APN 6 87056163 missense probably damaging 1.00
IGL00946:Gfpt1 APN 6 87050942 missense probably damaging 1.00
IGL01083:Gfpt1 APN 6 87054696 missense probably damaging 1.00
IGL01930:Gfpt1 APN 6 87059415 missense possibly damaging 0.88
IGL02113:Gfpt1 APN 6 87087367 missense probably benign 0.04
IGL02724:Gfpt1 APN 6 87056182 nonsense probably null
IGL03024:Gfpt1 APN 6 87053831 missense probably damaging 1.00
R0829:Gfpt1 UTSW 6 87053865 splice site probably benign
R1779:Gfpt1 UTSW 6 87077197 missense possibly damaging 0.74
R1982:Gfpt1 UTSW 6 87054630 missense possibly damaging 0.90
R2067:Gfpt1 UTSW 6 87057754 missense probably benign 0.02
R2400:Gfpt1 UTSW 6 87087348 missense probably damaging 1.00
R3104:Gfpt1 UTSW 6 87057646 missense probably benign 0.16
R3105:Gfpt1 UTSW 6 87057646 missense probably benign 0.16
R4738:Gfpt1 UTSW 6 87054747 intron probably benign
R5070:Gfpt1 UTSW 6 87053745 splice site probably null
R5292:Gfpt1 UTSW 6 87076255 critical splice acceptor site probably null
R5392:Gfpt1 UTSW 6 87077157 missense probably damaging 0.99
R5481:Gfpt1 UTSW 6 87050969 missense probably damaging 1.00
R5646:Gfpt1 UTSW 6 87042999 start codon destroyed probably null 0.92
R5666:Gfpt1 UTSW 6 87053813 missense possibly damaging 0.94
R6003:Gfpt1 UTSW 6 87088248 unclassified probably null
R6031:Gfpt1 UTSW 6 87086320 missense probably damaging 1.00
R6031:Gfpt1 UTSW 6 87086320 missense probably damaging 1.00
R6045:Gfpt1 UTSW 6 87085257 missense probably damaging 1.00
R6341:Gfpt1 UTSW 6 87088145 missense probably damaging 1.00
R6980:Gfpt1 UTSW 6 87077089 missense probably damaging 1.00
R7120:Gfpt1 UTSW 6 87087393 missense probably benign 0.25
R7123:Gfpt1 UTSW 6 87056186 missense probably damaging 1.00
R7249:Gfpt1 UTSW 6 87056144 missense probably damaging 0.98
R7374:Gfpt1 UTSW 6 87050977 missense probably benign 0.00
R7501:Gfpt1 UTSW 6 87082526 missense probably benign
R7502:Gfpt1 UTSW 6 87066689 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAATCCTAGAAAATATTTGCTGCCT -3'
(R):5'- TAAATGGAGGTGTGTAGGCAC -3'

Sequencing Primer
(F):5'- CCCAGTGGTTTAGAAAACGCATTG -3'
(R):5'- CAAGGTAGGGTCTCTCACTTGAAC -3'
Posted On2014-11-12