Mutagenetix > Incidental Mutation

Incidental Mutation 'R0308:Sorbs2'

24971

Institutional Source

Beutler Lab

Gene Symbol

Sorbs2

Ensembl Gene

ENSMUSG00000031626

Gene Name

sorbin and SH3 domain containing 2

Synonyms

MMRRC Submission

038518-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0308 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45507788-45827906 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 45795130 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 473 (Q473*)

Ref Sequence

ENSEMBL: ENSMUSP00000128000 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067065] [ENSMUST00000067107] [ENSMUST00000125295] [ENSMUST00000130011] [ENSMUST00000132139] [ENSMUST00000135336] [ENSMUST00000138049] [ENSMUST00000139869] [ENSMUST00000153798] [ENSMUST00000171337] [ENSMUST00000211095]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000067065
AA Change: Q338*

SMART Domains

Protein: ENSMUSP00000070720
Gene: ENSMUSG00000031626
AA Change: Q338*

Domain	Start	End	E-Value	Type
low complexity region	48	61	N/A	INTRINSIC
low complexity region	105	121	N/A	INTRINSIC
low complexity region	136	154	N/A	INTRINSIC
low complexity region	266	283	N/A	INTRINSIC
low complexity region	362	373	N/A	INTRINSIC
low complexity region	606	618	N/A	INTRINSIC
low complexity region	619	630	N/A	INTRINSIC
SH3	845	900	5.1e-23	SMART
low complexity region	901	916	N/A	INTRINSIC
SH3	920	977	3.9e-19	SMART
SH3	1023	1079	2.48e-12	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000067107
AA Change: Q454*

SMART Domains

Protein: ENSMUSP00000067641
Gene: ENSMUSG00000031626
AA Change: Q454*

Domain	Start	End	E-Value	Type
Sorb	167	217	9.63e-34	SMART
low complexity region	264	277	N/A	INTRINSIC
low complexity region	382	399	N/A	INTRINSIC
low complexity region	478	489	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	735	746	N/A	INTRINSIC
SH3	962	1017	5.1e-23	SMART
low complexity region	1018	1033	N/A	INTRINSIC
SH3	1037	1094	3.9e-19	SMART
SH3	1140	1196	2.48e-12	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000125295
AA Change: Q393*

SMART Domains

Protein: ENSMUSP00000116768
Gene: ENSMUSG00000031626
AA Change: Q393*

Domain	Start	End	E-Value	Type
Sorb	6	56	9.63e-34	SMART
low complexity region	103	116	N/A	INTRINSIC
low complexity region	160	176	N/A	INTRINSIC
low complexity region	191	209	N/A	INTRINSIC
low complexity region	321	338	N/A	INTRINSIC
low complexity region	417	428	N/A	INTRINSIC
low complexity region	661	673	N/A	INTRINSIC
low complexity region	674	685	N/A	INTRINSIC
SH3	900	955	5.1e-23	SMART
low complexity region	956	971	N/A	INTRINSIC
SH3	975	1032	3.9e-19	SMART
SH3	1078	1134	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130011

SMART Domains

Protein: ENSMUSP00000121619
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	113	163	1.01e-27	SMART
low complexity region	195	208	N/A	INTRINSIC
low complexity region	252	268	N/A	INTRINSIC
low complexity region	283	301	N/A	INTRINSIC
low complexity region	366	383	N/A	INTRINSIC
SH3	418	473	5.1e-23	SMART
low complexity region	474	489	N/A	INTRINSIC
SH3	493	550	3.9e-19	SMART
SH3	596	652	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132139

SMART Domains

Protein: ENSMUSP00000123250
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	144	194	9.63e-34	SMART
low complexity region	241	254	N/A	INTRINSIC
low complexity region	298	314	N/A	INTRINSIC
low complexity region	329	347	N/A	INTRINSIC
low complexity region	431	448	N/A	INTRINSIC
SH3	483	538	5.1e-23	SMART
low complexity region	539	554	N/A	INTRINSIC
SH3	558	615	3.9e-19	SMART
SH3	636	707	2.16e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132767

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135116

Predicted Effect

probably null
Transcript: ENSMUST00000135336
AA Change: Q454*

SMART Domains

Protein: ENSMUSP00000114286
Gene: ENSMUSG00000031626
AA Change: Q454*

Domain	Start	End	E-Value	Type
Sorb	167	217	9.63e-34	SMART
low complexity region	264	277	N/A	INTRINSIC
low complexity region	382	399	N/A	INTRINSIC
low complexity region	478	489	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	735	746	N/A	INTRINSIC
SH3	962	1017	5.1e-23	SMART
low complexity region	1018	1033	N/A	INTRINSIC
SH3	1037	1094	3.9e-19	SMART
SH3	1140	1196	2.48e-12	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000138049
AA Change: Q439*

SMART Domains

Protein: ENSMUSP00000123503
Gene: ENSMUSG00000031626
AA Change: Q439*

Domain	Start	End	E-Value	Type
Sorb	167	217	1.01e-27	SMART
low complexity region	249	262	N/A	INTRINSIC
low complexity region	367	384	N/A	INTRINSIC
low complexity region	463	474	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139869

SMART Domains

Protein: ENSMUSP00000121235
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	136	186	1.01e-27	SMART
low complexity region	218	231	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
SH3	389	444	5.1e-23	SMART
low complexity region	445	460	N/A	INTRINSIC
SH3	464	521	3.9e-19	SMART
SH3	567	623	2.48e-12	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000140088

SMART Domains

Protein: ENSMUSP00000114158
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	2	25	9.17e-1	SMART
low complexity region	57	70	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000146627

SMART Domains

Protein: ENSMUSP00000120487
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
low complexity region	10	26	N/A	INTRINSIC
low complexity region	41	59	N/A	INTRINSIC
low complexity region	143	160	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153798

SMART Domains

Protein: ENSMUSP00000118353
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	136	186	9.63e-34	SMART
low complexity region	233	246	N/A	INTRINSIC
low complexity region	351	368	N/A	INTRINSIC
SH3	403	458	5.1e-23	SMART
low complexity region	459	474	N/A	INTRINSIC
SH3	478	535	3.9e-19	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000155858

SMART Domains

Protein: ENSMUSP00000122820
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
low complexity region	50	63	N/A	INTRINSIC
low complexity region	107	123	N/A	INTRINSIC
low complexity region	138	156	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000171337
AA Change: Q473*

SMART Domains

Protein: ENSMUSP00000128000
Gene: ENSMUSG00000031626
AA Change: Q473*

Domain	Start	End	E-Value	Type
Sorb	167	217	9.63e-34	SMART
low complexity region	264	277	N/A	INTRINSIC
low complexity region	401	418	N/A	INTRINSIC
low complexity region	497	508	N/A	INTRINSIC
low complexity region	741	753	N/A	INTRINSIC
low complexity region	754	765	N/A	INTRINSIC
SH3	980	1035	5.1e-23	SMART
low complexity region	1036	1051	N/A	INTRINSIC
SH3	1055	1112	3.9e-19	SMART
SH3	1158	1214	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000211095

Meta Mutation Damage Score

0.9715

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 95.1%
20x: 89.5%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arg and c-Abl represent the mammalian members of the Abelson family of non-receptor protein-tyrosine kinases. They interact with the Arg/Abl binding proteins via the SH3 domains present in the carboxy end of the latter group of proteins. This gene encodes the sorbin and SH3 domain containing 2 protein. It has three C-terminal SH3 domains and an N-terminal sorbin homology (SoHo) domain that interacts with lipid raft proteins. The subcellular localization of this protein in epithelial and cardiac muscle cells suggests that it functions as an adapter protein to assemble signaling complexes in stress fibers, and that it is a potential link between Abl family kinases and the actin cytoskeleton. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, reduced dendritic complexity, decreased excitatory synaptic transmission in dentate gyrus granule cells, a reduced acoustic startle response, and impaired long-term object recognition memory and contextual fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700009N14Rik	A	T	4: 39,450,989	D65V	probably damaging	Het
4933407L21Rik	A	T	1: 85,931,286		probably benign	Het
Abcc12	C	T	8: 86,557,752		probably benign	Het
Adamts12	A	G	15: 11,311,560	E1301G	probably damaging	Het
Adh4	A	T	3: 138,424,102	N230Y	probably damaging	Het
Anapc15-ps	T	A	10: 95,673,092	M109L	probably benign	Het
Angpt2	T	C	8: 18,692,125	I472V	possibly damaging	Het
Arhgef26	C	A	3: 62,340,399	D301E	probably benign	Het
Armc10	G	A	5: 21,647,297		probably benign	Het
Arntl	A	T	7: 113,291,536	I179F	probably damaging	Het
Atm	T	C	9: 53,454,473		probably null	Het
Atp5b	T	C	10: 128,086,039	V265A	probably benign	Het
Atp8b1	G	T	18: 64,545,244	C860*	probably null	Het
Atrnl1	T	G	19: 57,753,288	S1160A	probably benign	Het
Cep55	A	G	19: 38,060,211	E105G	possibly damaging	Het
Cfap54	C	A	10: 92,885,364	D2502Y	unknown	Het
Cilp2	A	G	8: 69,882,993	S452P	probably benign	Het
Clptm1l	A	G	13: 73,611,667	D282G	possibly damaging	Het
Csrp1	C	A	1: 135,745,286	T47N	probably damaging	Het
Cyp2c40	T	A	19: 39,777,988	I388F	probably damaging	Het
Dars	C	T	1: 128,364,259	R494H	probably damaging	Het
Dna2	T	C	10: 62,956,974	V256A	probably damaging	Het
Dock7	T	C	4: 98,984,814	T1132A	probably benign	Het
Elk3	A	T	10: 93,265,205	M228K	probably benign	Het
Erich6	A	G	3: 58,636,104	F182L	probably damaging	Het
Fhad1	A	G	4: 141,985,593		probably benign	Het
Fryl	A	T	5: 73,041,604		probably benign	Het
Fzd9	A	T	5: 135,249,406	C542S	probably damaging	Het
Gba	A	G	3: 89,208,364	T460A	probably benign	Het
Gli2	C	T	1: 118,842,062	A587T	probably benign	Het
Gm10037	A	G	13: 67,843,113		probably benign	Het
Gm11011	C	T	2: 169,582,694		probably benign	Het
Gm17018	T	G	19: 45,577,006	F140V	probably damaging	Het
Gm9745	T	G	13: 8,940,841		probably benign	Het
Gmppb	A	G	9: 108,049,834	E68G	probably benign	Het
Gpld1	A	G	13: 24,962,835	N260S	possibly damaging	Het
Hipk3	G	A	2: 104,433,207	S900L	probably damaging	Het
Ints6l	A	T	X: 56,481,355	M215L	possibly damaging	Het
Irx6	T	A	8: 92,677,031	L128Q	probably damaging	Het
Itga10	T	C	3: 96,651,464	S373P	probably damaging	Het
Jak1	T	C	4: 101,154,535		probably null	Het
Jak2	C	T	19: 29,311,757	T1103I	probably benign	Het
Katnal1	A	T	5: 148,878,924	V401D	possibly damaging	Het
Lrp2	T	A	2: 69,482,982		probably benign	Het
Map3k13	A	G	16: 21,891,988	H7R	probably benign	Het
Mrgprx3-ps	A	G	7: 47,310,018	V75A	probably benign	Het
Nol6	C	T	4: 41,123,584	A55T	probably benign	Het
Olfr881	A	G	9: 37,992,845	I118V	probably benign	Het
Opa1	G	A	16: 29,621,531	R818Q	probably damaging	Het
Opn4	T	C	14: 34,597,124	Y168C	possibly damaging	Het
Phf21a	T	C	2: 92,330,777	V330A	possibly damaging	Het
Phykpl	A	G	11: 51,593,596		probably benign	Het
Plcb1	T	G	2: 134,813,614	V38G	probably benign	Het
Plxna4	T	A	6: 32,237,768	T593S	probably benign	Het
Poll	A	T	19: 45,555,965	I339N	probably damaging	Het
Rev3l	A	G	10: 39,824,894	I1796V	probably benign	Het
Rnf103	G	A	6: 71,509,702	R439H	probably damaging	Het
Rrn3	G	A	16: 13,799,882		probably benign	Het
Sec14l4	G	A	11: 4,041,726		probably benign	Het
Sec23a	A	C	12: 59,007,199	Y4*	probably null	Het
Senp6	T	C	9: 80,132,983		probably null	Het
Serpinb6b	A	T	13: 32,978,237	N221Y	probably benign	Het
Slc6a2	A	G	8: 92,961,360	E38G	possibly damaging	Het
Smap1	A	T	1: 23,849,342	L196I	probably damaging	Het
Sphkap	C	A	1: 83,276,969	V1020F	probably damaging	Het
Srfbp1	T	C	18: 52,488,542	V225A	probably benign	Het
Srprb	G	A	9: 103,202,005	P728S	possibly damaging	Het
Tarm1	T	C	7: 3,496,671		probably benign	Het
Tcp1	T	A	17: 12,920,419	I162N	probably benign	Het
Tmem237	C	A	1: 59,107,517	A292S	probably damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Tnpo1	A	G	13: 98,846,503	F884L	probably damaging	Het
Trim7	A	G	11: 48,849,501	T142A	probably damaging	Het
Ttn	T	A	2: 76,785,680	I14894F	probably damaging	Het
Tubgcp6	T	C	15: 89,122,436	R128G	possibly damaging	Het
Ube2d2b	A	G	5: 107,830,908	T142A	possibly damaging	Het
Unc13c	G	T	9: 73,481,118	L2129I	probably benign	Het
Ushbp1	T	C	8: 71,391,053	D247G	probably damaging	Het
Usp43	G	A	11: 67,880,140	A556V	probably damaging	Het
Zfp438	T	A	18: 5,213,638	H440L	probably benign	Het
Zfp518b	C	T	5: 38,672,770	E631K	possibly damaging	Het

Other mutations in Sorbs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Sorbs2	APN	8	45799706	splice site	probably null
IGL00964:Sorbs2	APN	8	45795677	missense	probably damaging	0.97
IGL01101:Sorbs2	APN	8	45745423	missense	possibly damaging	0.93
IGL01586:Sorbs2	APN	8	45795594	missense	probably damaging	1.00
IGL01611:Sorbs2	APN	8	45795344	missense	probably null
IGL01662:Sorbs2	APN	8	45803829	splice site	probably benign
IGL01970:Sorbs2	APN	8	45745803	missense	probably damaging	1.00
IGL02169:Sorbs2	APN	8	45823749	missense	probably damaging	0.98
IGL02685:Sorbs2	APN	8	45803840	missense	probably benign	0.00
IGL03036:Sorbs2	APN	8	45782865	missense	probably benign
IGL03151:Sorbs2	APN	8	45799713	missense	probably benign	0.01
IGL03164:Sorbs2	APN	8	45782874	missense	probably benign	0.01
IGL03350:Sorbs2	APN	8	45805807	missense	probably damaging	0.99
BB001:Sorbs2	UTSW	8	45795470	missense	probably damaging	1.00
BB011:Sorbs2	UTSW	8	45795470	missense	probably damaging	1.00
R0058:Sorbs2	UTSW	8	45785254	splice site	probably null
R0058:Sorbs2	UTSW	8	45796263	missense	probably damaging	1.00
R0233:Sorbs2	UTSW	8	45769829	missense	probably damaging	1.00
R0233:Sorbs2	UTSW	8	45769829	missense	probably damaging	1.00
R0265:Sorbs2	UTSW	8	45785337	splice site	probably benign
R0306:Sorbs2	UTSW	8	45795730	missense	probably benign	0.00
R0638:Sorbs2	UTSW	8	45796310	missense	probably damaging	1.00
R0940:Sorbs2	UTSW	8	45796502	missense	probably benign	0.39
R1110:Sorbs2	UTSW	8	45795730	missense	probably benign	0.13
R1160:Sorbs2	UTSW	8	45770576	missense	probably damaging	1.00
R1226:Sorbs2	UTSW	8	45795619	missense	probably damaging	1.00
R1271:Sorbs2	UTSW	8	45795967	missense	probably damaging	1.00
R1440:Sorbs2	UTSW	8	45789963	splice site	probably benign
R1514:Sorbs2	UTSW	8	45769829	missense	probably damaging	1.00
R1557:Sorbs2	UTSW	8	45759197	splice site	probably benign
R1582:Sorbs2	UTSW	8	45805777	missense	probably damaging	0.99
R1626:Sorbs2	UTSW	8	45769854	missense	probably damaging	1.00
R1700:Sorbs2	UTSW	8	45800984	missense	probably damaging	1.00
R1759:Sorbs2	UTSW	8	45763019	makesense	probably null
R1766:Sorbs2	UTSW	8	45770576	missense	probably damaging	1.00
R1782:Sorbs2	UTSW	8	45805696	missense	probably damaging	1.00
R1932:Sorbs2	UTSW	8	45796352	missense	probably benign	0.01
R1954:Sorbs2	UTSW	8	45745738	missense	probably benign	0.23
R2060:Sorbs2	UTSW	8	45775629	missense	probably damaging	1.00
R2149:Sorbs2	UTSW	8	45795443	missense	probably damaging	0.99
R2568:Sorbs2	UTSW	8	45795370	nonsense	probably null
R3812:Sorbs2	UTSW	8	45763030	missense	probably benign	0.00
R3831:Sorbs2	UTSW	8	45795095	missense	probably damaging	1.00
R3975:Sorbs2	UTSW	8	45772710	critical splice donor site	probably null
R4033:Sorbs2	UTSW	8	45775595	missense	probably damaging	1.00
R4714:Sorbs2	UTSW	8	45795293	missense	possibly damaging	0.89
R4828:Sorbs2	UTSW	8	45741615	intron	probably benign
R4926:Sorbs2	UTSW	8	45796217	missense	probably benign	0.03
R5027:Sorbs2	UTSW	8	45746534	splice site	probably null
R5118:Sorbs2	UTSW	8	45795785	missense	probably damaging	1.00
R5159:Sorbs2	UTSW	8	45795730	missense	probably benign	0.00
R5342:Sorbs2	UTSW	8	45796013	missense	probably damaging	0.96
R5390:Sorbs2	UTSW	8	45819741	missense	probably damaging	1.00
R5436:Sorbs2	UTSW	8	45796001	missense	probably damaging	1.00
R5655:Sorbs2	UTSW	8	45741581	critical splice donor site	probably null
R5687:Sorbs2	UTSW	8	45775632	missense	probably damaging	1.00
R5695:Sorbs2	UTSW	8	45792875	missense	probably benign	0.27
R5733:Sorbs2	UTSW	8	45759189	missense	probably damaging	1.00
R5928:Sorbs2	UTSW	8	45763183	missense	probably damaging	1.00
R5949:Sorbs2	UTSW	8	45769897	critical splice donor site	probably null
R6341:Sorbs2	UTSW	8	45770578	missense	probably damaging	1.00
R6620:Sorbs2	UTSW	8	45796176	missense	probably damaging	1.00
R6761:Sorbs2	UTSW	8	45772614	missense	probably damaging	1.00
R7349:Sorbs2	UTSW	8	45795823	nonsense	probably null
R7404:Sorbs2	UTSW	8	45759196	splice site	probably null
R7524:Sorbs2	UTSW	8	45795656	missense	probably benign	0.00
R7809:Sorbs2	UTSW	8	45745428	missense	possibly damaging	0.93
R7820:Sorbs2	UTSW	8	45796556	missense	probably null	0.16
R7924:Sorbs2	UTSW	8	45795470	missense	probably damaging	1.00
R8285:Sorbs2	UTSW	8	45796067	missense	probably damaging	0.98
R8696:Sorbs2	UTSW	8	45795649	missense	possibly damaging	0.95
R8927:Sorbs2	UTSW	8	45795915	missense	probably damaging	1.00
R8928:Sorbs2	UTSW	8	45795915	missense	probably damaging	1.00
R9005:Sorbs2	UTSW	8	45795737	missense	probably benign
R9006:Sorbs2	UTSW	8	45805821	missense	possibly damaging	0.95
R9016:Sorbs2	UTSW	8	45795737	missense	probably benign
R9017:Sorbs2	UTSW	8	45795737	missense	probably benign
R9091:Sorbs2	UTSW	8	45795737	missense	probably benign
R9196:Sorbs2	UTSW	8	45805827	missense	probably benign	0.12
R9256:Sorbs2	UTSW	8	45795737	missense	probably benign
R9282:Sorbs2	UTSW	8	45795737	missense	probably benign
R9283:Sorbs2	UTSW	8	45795737	missense	probably benign
R9384:Sorbs2	UTSW	8	45805827	missense	probably benign	0.12
R9624:Sorbs2	UTSW	8	45775653	missense	possibly damaging	0.89
R9664:Sorbs2	UTSW	8	45823751	missense	probably benign	0.05
Z1176:Sorbs2	UTSW	8	45790025	missense	probably null	0.96
Z1177:Sorbs2	UTSW	8	45782959	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGATAGCAAAATGTGTCCGCCCC -3'
(R):5'- CCTGGATTTCACCGAGCAAATGACC -3'

Sequencing Primer
(F):5'- CTTTGCAGTTACTCGGGGC -3'
(R):5'- CGCACACTTCCTGGATGTAG -3'

Posted On

2013-04-16