Incidental Mutation 'R2439:Umad1'
ID 249728
Institutional Source Beutler Lab
Gene Symbol Umad1
Ensembl Gene ENSMUSG00000089862
Gene Name UMAP1-MVP12 associated (UMA) domain containing 1
Synonyms Gm16039
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock # R2439 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 8259288-8459470 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 8427078 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 110 (D110E)
Ref Sequence ENSEMBL: ENSMUSP00000124993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159168] [ENSMUST00000159335] [ENSMUST00000159378] [ENSMUST00000159433] [ENSMUST00000160705] [ENSMUST00000162034] [ENSMUST00000162564]
AlphaFold E0CX23
Predicted Effect probably damaging
Transcript: ENSMUST00000159168
AA Change: D84E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000159335
AA Change: D84E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000159378
AA Change: D84E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000159433
AA Change: D84E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160030
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160253
Predicted Effect probably damaging
Transcript: ENSMUST00000160705
AA Change: D110E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000162034
SMART Domains Protein: ENSMUSP00000124306
Gene: ENSMUSG00000089862

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162564
AA Change: D84E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A G 11: 58,610,777 C127R probably damaging Het
Atp11b C A 3: 35,814,084 T635K possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Btla G T 16: 45,239,140 C69F probably damaging Het
Cdh10 T G 15: 19,013,398 L695V probably damaging Het
Cfap44 C T 16: 44,481,246 probably benign Het
Dock10 T G 1: 80,532,432 N1560H probably damaging Het
Ephb6 C A 6: 41,618,735 H809Q probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Gdf7 A G 12: 8,298,050 S416P probably damaging Het
Ints8 T C 4: 11,225,725 M611V probably benign Het
Micalcl A G 7: 112,394,795 E504G probably damaging Het
Mrps30 G A 13: 118,385,272 P231S probably damaging Het
Nr1h3 T C 2: 91,190,220 D256G probably benign Het
Pramel5 T C 4: 144,273,740 M89V probably benign Het
Psg18 T C 7: 18,346,119 T386A probably benign Het
Ptprc A G 1: 138,066,152 V1180A possibly damaging Het
Rassf8 T C 6: 145,815,334 S129P probably damaging Het
Rbm6 A G 9: 107,779,597 Y994H probably damaging Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Slc2a4 A G 11: 69,945,625 F222S possibly damaging Het
Smarca2 T C 19: 26,691,454 probably null Het
Tmtc4 T G 14: 122,971,903 N110T probably damaging Het
Tsc22d1 TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA 14: 76,417,267 probably benign Het
Ylpm1 A G 12: 85,014,117 probably benign Het
Other mutations in Umad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1878:Umad1 UTSW 6 8427181 missense probably damaging 1.00
R2403:Umad1 UTSW 6 8427161 missense possibly damaging 0.84
R4774:Umad1 UTSW 6 8427181 missense probably damaging 1.00
R4816:Umad1 UTSW 6 8457462 intron probably benign
R5068:Umad1 UTSW 6 8401157 splice site probably null
R7130:Umad1 UTSW 6 8427185 missense probably null 0.01
R7487:Umad1 UTSW 6 8270560 missense probably damaging 1.00
R7654:Umad1 UTSW 6 8426995 missense probably damaging 0.99
R7843:Umad1 UTSW 6 8401140 missense unknown
R8103:Umad1 UTSW 6 8427121 missense probably damaging 0.97
R9011:Umad1 UTSW 6 8373931 nonsense probably null
R9432:Umad1 UTSW 6 8401096 missense unknown
Predicted Primers PCR Primer
(F):5'- AATGGGTTCAAATCTGGCAGG -3'
(R):5'- AAGCTGCTAGGGTATGCATAGAC -3'

Sequencing Primer
(F):5'- CCAGGCTTTTTGATGTACTGATGCC -3'
(R):5'- CTGCTAGGGTATGCATAGACACAAAG -3'
Posted On 2014-11-12