Incidental Mutation 'R0308:Abcc12'
ID24973
Institutional Source Beutler Lab
Gene Symbol Abcc12
Ensembl Gene ENSMUSG00000036872
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 12
Synonyms4930467B22Rik, MRP9
MMRRC Submission 038518-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0308 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location86482260-86580686 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 86557752 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080115] [ENSMUST00000129898] [ENSMUST00000131423] [ENSMUST00000131806] [ENSMUST00000152438] [ENSMUST00000156610]
Predicted Effect probably benign
Transcript: ENSMUST00000080115
SMART Domains Protein: ENSMUSP00000079014
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 3.6e-19 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Pfam:ABC_membrane 791 1079 1.3e-26 PFAM
AAA 1153 1346 1.07e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129898
SMART Domains Protein: ENSMUSP00000122577
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.2e-19 PFAM
AAA 506 679 3.33e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131423
SMART Domains Protein: ENSMUSP00000122402
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.1e-21 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Pfam:ABC_membrane 792 1077 1.6e-34 PFAM
AAA 1153 1346 1.07e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131806
SMART Domains Protein: ENSMUSP00000116866
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.3e-19 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152438
SMART Domains Protein: ENSMUSP00000114582
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.2e-19 PFAM
AAA 506 679 3.33e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156610
SMART Domains Protein: ENSMUSP00000123578
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 5.9e-20 PFAM
AAA 506 661 1.07e-7 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two ATP-binding domains and 12 transmembrane regions. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies: ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White. This gene is a member of the MRP subfamily which is involved in multi-drug resistance. This gene and another subfamily member are arranged head-to-tail on chromosome 16q12.1. Increased expression of this gene is associated with breast cancer. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,989 D65V probably damaging Het
4933407L21Rik A T 1: 85,931,286 probably benign Het
Adamts12 A G 15: 11,311,560 E1301G probably damaging Het
Adh4 A T 3: 138,424,102 N230Y probably damaging Het
Anapc15-ps T A 10: 95,673,092 M109L probably benign Het
Angpt2 T C 8: 18,692,125 I472V possibly damaging Het
Arhgef26 C A 3: 62,340,399 D301E probably benign Het
Armc10 G A 5: 21,647,297 probably benign Het
Arntl A T 7: 113,291,536 I179F probably damaging Het
Atm T C 9: 53,454,473 probably null Het
Atp5b T C 10: 128,086,039 V265A probably benign Het
Atp8b1 G T 18: 64,545,244 C860* probably null Het
Atrnl1 T G 19: 57,753,288 S1160A probably benign Het
Cep55 A G 19: 38,060,211 E105G possibly damaging Het
Cfap54 C A 10: 92,885,364 D2502Y unknown Het
Cilp2 A G 8: 69,882,993 S452P probably benign Het
Clptm1l A G 13: 73,611,667 D282G possibly damaging Het
Csrp1 C A 1: 135,745,286 T47N probably damaging Het
Cyp2c40 T A 19: 39,777,988 I388F probably damaging Het
Dars C T 1: 128,364,259 R494H probably damaging Het
Dna2 T C 10: 62,956,974 V256A probably damaging Het
Dock7 T C 4: 98,984,814 T1132A probably benign Het
Elk3 A T 10: 93,265,205 M228K probably benign Het
Erich6 A G 3: 58,636,104 F182L probably damaging Het
Fhad1 A G 4: 141,985,593 probably benign Het
Fryl A T 5: 73,041,604 probably benign Het
Fzd9 A T 5: 135,249,406 C542S probably damaging Het
Gba A G 3: 89,208,364 T460A probably benign Het
Gli2 C T 1: 118,842,062 A587T probably benign Het
Gm10037 A G 13: 67,843,113 probably benign Het
Gm11011 C T 2: 169,582,694 probably benign Het
Gm17018 T G 19: 45,577,006 F140V probably damaging Het
Gm9745 T G 13: 8,940,841 probably benign Het
Gmppb A G 9: 108,049,834 E68G probably benign Het
Gpld1 A G 13: 24,962,835 N260S possibly damaging Het
Hipk3 G A 2: 104,433,207 S900L probably damaging Het
Ints6l A T X: 56,481,355 M215L possibly damaging Het
Irx6 T A 8: 92,677,031 L128Q probably damaging Het
Itga10 T C 3: 96,651,464 S373P probably damaging Het
Jak1 T C 4: 101,154,535 probably null Het
Jak2 C T 19: 29,311,757 T1103I probably benign Het
Katnal1 A T 5: 148,878,924 V401D possibly damaging Het
Lrp2 T A 2: 69,482,982 probably benign Het
Map3k13 A G 16: 21,891,988 H7R probably benign Het
Mrgprx3-ps A G 7: 47,310,018 V75A probably benign Het
Nol6 C T 4: 41,123,584 A55T probably benign Het
Olfr881 A G 9: 37,992,845 I118V probably benign Het
Opa1 G A 16: 29,621,531 R818Q probably damaging Het
Opn4 T C 14: 34,597,124 Y168C possibly damaging Het
Phf21a T C 2: 92,330,777 V330A possibly damaging Het
Phykpl A G 11: 51,593,596 probably benign Het
Plcb1 T G 2: 134,813,614 V38G probably benign Het
Plxna4 T A 6: 32,237,768 T593S probably benign Het
Poll A T 19: 45,555,965 I339N probably damaging Het
Rev3l A G 10: 39,824,894 I1796V probably benign Het
Rnf103 G A 6: 71,509,702 R439H probably damaging Het
Rrn3 G A 16: 13,799,882 probably benign Het
Sec14l4 G A 11: 4,041,726 probably benign Het
Sec23a A C 12: 59,007,199 Y4* probably null Het
Senp6 T C 9: 80,132,983 probably null Het
Serpinb6b A T 13: 32,978,237 N221Y probably benign Het
Slc6a2 A G 8: 92,961,360 E38G possibly damaging Het
Smap1 A T 1: 23,849,342 L196I probably damaging Het
Sorbs2 C T 8: 45,795,130 Q473* probably null Het
Sphkap C A 1: 83,276,969 V1020F probably damaging Het
Srfbp1 T C 18: 52,488,542 V225A probably benign Het
Srprb G A 9: 103,202,005 P728S possibly damaging Het
Tarm1 T C 7: 3,496,671 probably benign Het
Tcp1 T A 17: 12,920,419 I162N probably benign Het
Tmem237 C A 1: 59,107,517 A292S probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnpo1 A G 13: 98,846,503 F884L probably damaging Het
Trim7 A G 11: 48,849,501 T142A probably damaging Het
Ttn T A 2: 76,785,680 I14894F probably damaging Het
Tubgcp6 T C 15: 89,122,436 R128G possibly damaging Het
Ube2d2b A G 5: 107,830,908 T142A possibly damaging Het
Unc13c G T 9: 73,481,118 L2129I probably benign Het
Ushbp1 T C 8: 71,391,053 D247G probably damaging Het
Usp43 G A 11: 67,880,140 A556V probably damaging Het
Zfp438 T A 18: 5,213,638 H440L probably benign Het
Zfp518b C T 5: 38,672,770 E631K possibly damaging Het
Other mutations in Abcc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Abcc12 APN 8 86534693 missense probably benign 0.45
IGL01504:Abcc12 APN 8 86557602 missense probably damaging 1.00
IGL01593:Abcc12 APN 8 86557650 missense probably damaging 1.00
IGL02164:Abcc12 APN 8 86527404 missense probably damaging 1.00
IGL02173:Abcc12 APN 8 86566442 missense probably damaging 1.00
IGL02175:Abcc12 APN 8 86535013 splice site probably null
IGL02405:Abcc12 APN 8 86558153 missense probably damaging 0.98
IGL02620:Abcc12 APN 8 86505314 splice site probably null
IGL02635:Abcc12 APN 8 86509682 splice site probably benign
IGL03241:Abcc12 APN 8 86509807 missense possibly damaging 0.77
PIT4544001:Abcc12 UTSW 8 86505246 missense possibly damaging 0.58
R0023:Abcc12 UTSW 8 86538333 missense probably damaging 1.00
R0023:Abcc12 UTSW 8 86538333 missense probably damaging 1.00
R0116:Abcc12 UTSW 8 86534998 missense probably benign 0.00
R0131:Abcc12 UTSW 8 86531568 missense probably benign
R0131:Abcc12 UTSW 8 86531568 missense probably benign
R0132:Abcc12 UTSW 8 86531568 missense probably benign
R0589:Abcc12 UTSW 8 86560472 missense possibly damaging 0.86
R1451:Abcc12 UTSW 8 86557693 missense probably damaging 1.00
R1564:Abcc12 UTSW 8 86517486 missense probably benign 0.10
R1740:Abcc12 UTSW 8 86505497 nonsense probably null
R1740:Abcc12 UTSW 8 86509771 missense possibly damaging 0.78
R1970:Abcc12 UTSW 8 86527281 missense probably benign 0.27
R2017:Abcc12 UTSW 8 86563988 missense probably damaging 1.00
R2026:Abcc12 UTSW 8 86558233 missense probably benign 0.30
R2402:Abcc12 UTSW 8 86509141 missense probably damaging 1.00
R3085:Abcc12 UTSW 8 86543907 splice site probably benign
R3115:Abcc12 UTSW 8 86540024 critical splice donor site probably null
R3176:Abcc12 UTSW 8 86506866 missense probably damaging 1.00
R3276:Abcc12 UTSW 8 86506866 missense probably damaging 1.00
R3847:Abcc12 UTSW 8 86553391 missense probably benign 0.05
R3911:Abcc12 UTSW 8 86528419 splice site probably benign
R4031:Abcc12 UTSW 8 86517448 missense probably damaging 1.00
R4297:Abcc12 UTSW 8 86531525 splice site probably null
R4298:Abcc12 UTSW 8 86531525 splice site probably null
R4299:Abcc12 UTSW 8 86531525 splice site probably null
R4688:Abcc12 UTSW 8 86548694 missense possibly damaging 0.46
R4810:Abcc12 UTSW 8 86560842 missense probably damaging 1.00
R4863:Abcc12 UTSW 8 86538376 missense probably damaging 1.00
R4892:Abcc12 UTSW 8 86509802 missense probably benign 0.28
R5288:Abcc12 UTSW 8 86566539 missense probably damaging 1.00
R5303:Abcc12 UTSW 8 86509786 missense probably benign 0.15
R5332:Abcc12 UTSW 8 86524830 splice site probably null
R5386:Abcc12 UTSW 8 86517489 missense possibly damaging 0.82
R5457:Abcc12 UTSW 8 86509844 missense probably benign 0.03
R5900:Abcc12 UTSW 8 86566520 missense possibly damaging 0.90
R6035:Abcc12 UTSW 8 86517404 missense probably damaging 0.98
R6035:Abcc12 UTSW 8 86517404 missense probably damaging 0.98
R6291:Abcc12 UTSW 8 86566544 missense possibly damaging 0.72
R6518:Abcc12 UTSW 8 86509089
R6677:Abcc12 UTSW 8 86534752 missense possibly damaging 0.58
R7258:Abcc12 UTSW 8 86560857 missense possibly damaging 0.94
R7411:Abcc12 UTSW 8 86560850 missense possibly damaging 0.95
R7619:Abcc12 UTSW 8 86566553 missense probably damaging 1.00
R7808:Abcc12 UTSW 8 86507939 missense probably benign 0.03
R7828:Abcc12 UTSW 8 86528275 missense probably benign 0.08
R7834:Abcc12 UTSW 8 86531550 missense possibly damaging 0.81
R7834:Abcc12 UTSW 8 86558230 missense probably damaging 1.00
R7917:Abcc12 UTSW 8 86531550 missense possibly damaging 0.81
R7917:Abcc12 UTSW 8 86558230 missense probably damaging 1.00
X0027:Abcc12 UTSW 8 86553291 missense probably damaging 0.99
Z1088:Abcc12 UTSW 8 86560279 synonymous probably null
Z1176:Abcc12 UTSW 8 86550601 missense probably damaging 1.00
Z1177:Abcc12 UTSW 8 86527384 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACTTGAAGAACCCCTTAAGAGCACG -3'
(R):5'- TGACAGATTCCCAGTGGTTTCCTCC -3'

Sequencing Primer
(F):5'- GCTCCACCCATGTAAGTGC -3'
(R):5'- TGGTTTCCTCCAGGCCAAG -3'
Posted On2013-04-16