Mutagenetix > Incidental Mutations

Incidental Mutation 'R2439:Rassf8'

249730

Institutional Source

Beutler Lab

Gene Symbol

Rassf8

Ensembl Gene

ENSMUSG00000030259

Gene Name

Ras association (RalGDS/AF-6) domain family (N-terminal) member 8

Synonyms

5133400D11Rik, mHoj-1

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.774) question?

Stock #

R2439 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

145746748-145821079 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 145815334 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 129 (S129P)

Ref Sequence

ENSEMBL: ENSMUSP00000107333 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032388] [ENSMUST00000058538] [ENSMUST00000111704] [ENSMUST00000140966]

Predicted Effect

probably damaging
Transcript: ENSMUST00000032388
AA Change: S129P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000032388
Gene: ENSMUSG00000030259
AA Change: S129P

Domain	Start	End	E-Value	Type
RA	1	82	4.17e-11	SMART
coiled coil region	161	354	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000058538

Predicted Effect

probably damaging
Transcript: ENSMUST00000111704
AA Change: S129P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107333
Gene: ENSMUSG00000030259
AA Change: S129P

Domain	Start	End	E-Value	Type
RA	1	82	4.17e-11	SMART
coiled coil region	161	354	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140966

SMART Domains

Protein: ENSMUSP00000122684
Gene: ENSMUSG00000030259

Domain	Start	End	E-Value	Type
RA	1	80	7.85e-7	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-assocation domain family (RASSF) of tumor suppressor proteins. This gene is essential for maintaining adherens junction function in epithelial cells and has a role in epithelial cell migration. It is a lung tumor suppressor gene candidate. A chromosomal translocation t(12;22)(p11.2;q13.3) leading to the fusion of this gene and the FBLN1 gene is found in a complex type of synpolydactyly. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210407C18Rik	A	G	11: 58,610,777	C127R	probably damaging	Het
Atp11b	C	A	3: 35,814,084	T635K	possibly damaging	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Btla	G	T	16: 45,239,140	C69F	probably damaging	Het
Cdh10	T	G	15: 19,013,398	L695V	probably damaging	Het
Cfap44	C	T	16: 44,481,246		probably benign	Het
Dock10	T	G	1: 80,532,432	N1560H	probably damaging	Het
Ephb6	C	A	6: 41,618,735	H809Q	probably benign	Het
Eprs	G	A	1: 185,379,742		probably null	Het
Gdf7	A	G	12: 8,298,050	S416P	probably damaging	Het
Ints8	T	C	4: 11,225,725	M611V	probably benign	Het
Micalcl	A	G	7: 112,394,795	E504G	probably damaging	Het
Mrps30	G	A	13: 118,385,272	P231S	probably damaging	Het
Nr1h3	T	C	2: 91,190,220	D256G	probably benign	Het
Pramel5	T	C	4: 144,273,740	M89V	probably benign	Het
Psg18	T	C	7: 18,346,119	T386A	probably benign	Het
Ptprc	A	G	1: 138,066,152	V1180A	possibly damaging	Het
Rbm6	A	G	9: 107,779,597	Y994H	probably damaging	Het
Setx	GTGGCT	GT	2: 29,154,061		probably null	Het
Slc2a4	A	G	11: 69,945,625	F222S	possibly damaging	Het
Smarca2	T	C	19: 26,691,454		probably null	Het
Tmtc4	T	G	14: 122,971,903	N110T	probably damaging	Het
Tsc22d1	TCAGCAGCAGCAGCAGCAGCAGCAGCA	TCAGCAGCAGCAGCAGCAGCAGCA	14: 76,417,267		probably benign	Het
Umad1	T	A	6: 8,427,078	D110E	probably damaging	Het
Ylpm1	A	G	12: 85,014,117		probably benign	Het

Other mutations in Rassf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02973:Rassf8	APN	6	145817190	unclassified	probably benign
IGL03017:Rassf8	APN	6	145817198	splice site	probably null
IGL03091:Rassf8	APN	6	145815810	missense	probably benign	0.00
R0230:Rassf8	UTSW	6	145819974	unclassified	probably benign
R0967:Rassf8	UTSW	6	145819950	unclassified	probably benign
R1429:Rassf8	UTSW	6	145815190	missense	probably damaging	1.00
R1622:Rassf8	UTSW	6	145820103	unclassified	probably benign
R1738:Rassf8	UTSW	6	145815308	missense	probably benign	0.03
R1894:Rassf8	UTSW	6	145808473	missense	probably damaging	1.00
R2126:Rassf8	UTSW	6	145815182	missense	probably benign	0.00
R2238:Rassf8	UTSW	6	145817184	missense	probably damaging	1.00
R3699:Rassf8	UTSW	6	145820076	unclassified	probably benign
R4678:Rassf8	UTSW	6	145815082	missense	probably damaging	1.00
R4734:Rassf8	UTSW	6	145815540	missense	probably benign	0.34
R4826:Rassf8	UTSW	6	145816550	missense	probably damaging	1.00
R4910:Rassf8	UTSW	6	145815280	nonsense	probably null
R4988:Rassf8	UTSW	6	145817144	missense	possibly damaging	0.89
R5425:Rassf8	UTSW	6	145815542	missense	probably benign
R5620:Rassf8	UTSW	6	145820181	unclassified	probably benign
R5747:Rassf8	UTSW	6	145815815	missense	probably benign	0.00
R6136:Rassf8	UTSW	6	145815656	missense	probably benign	0.00
R6220:Rassf8	UTSW	6	145817133	missense	probably damaging	1.00
R7274:Rassf8	UTSW	6	145815569	missense	probably benign	0.03
R7315:Rassf8	UTSW	6	145815751	missense	probably benign
R7480:Rassf8	UTSW	6	145820031	missense	unknown
R7593:Rassf8	UTSW	6	145815403	missense	probably benign	0.08
R7714:Rassf8	UTSW	6	145815247	missense	probably damaging	0.98
R7962:Rassf8	UTSW	6	145815943	critical splice donor site	probably null
R8222:Rassf8	UTSW	6	145820057	missense	unknown
R8374:Rassf8	UTSW	6	145815137	nonsense	probably null
R8409:Rassf8	UTSW	6	145815703	missense	probably benign
Z1088:Rassf8	UTSW	6	145815482	missense	probably benign
Z1088:Rassf8	UTSW	6	145816616	missense	probably benign	0.41
Z1176:Rassf8	UTSW	6	145816642	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTAGTGACGTGCAGCTCATC -3'
(R):5'- TCCAGGCTACAGCTGTACTTC -3'

Sequencing Primer
(F):5'- AGCTCATCTTGCGTCGGACTG -3'
(R):5'- AGAACCGGATCTCTGCCTC -3'

Posted On

2014-11-12