Mutagenetix > Incidental Mutations

Incidental Mutation 'R2439:Mrps30'

249740

Institutional Source

Beutler Lab

Gene Symbol

Mrps30

Ensembl Gene

ENSMUSG00000021731

Gene Name

mitochondrial ribosomal protein S30

Synonyms

2610020A16Rik, Pdcd9

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.928) question?

Stock #

R2439 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118378381-118387252 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 118385272 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 231 (P231S)

Ref Sequence

ENSEMBL: ENSMUSP00000022245 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022245] [ENSMUST00000181168]

AlphaFold

Q9D0G0

Predicted Effect

probably damaging
Transcript: ENSMUST00000022245
AA Change: P231S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022245
Gene: ENSMUSG00000021731
AA Change: P231S

Domain	Start	End	E-Value	Type
Pfam:PDCD9	1	423	1.7e-180	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000181168

SMART Domains

Protein: ENSMUSP00000137680
Gene: ENSMUSG00000097411

Domain	Start	End	E-Value	Type
low complexity region	6	27	N/A	INTRINSIC
low complexity region	72	88	N/A	INTRINSIC
low complexity region	117	125	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225170

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that is similar to the chicken pro-apoptotic protein p52. Transcript variants using alternative promoters or polyA sites have been mentioned in the literature but the complete description of these sequences is not available. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210407C18Rik	A	G	11: 58,610,777	C127R	probably damaging	Het
Atp11b	C	A	3: 35,814,084	T635K	possibly damaging	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Btla	G	T	16: 45,239,140	C69F	probably damaging	Het
Cdh10	T	G	15: 19,013,398	L695V	probably damaging	Het
Cfap44	C	T	16: 44,481,246		probably benign	Het
Dock10	T	G	1: 80,532,432	N1560H	probably damaging	Het
Ephb6	C	A	6: 41,618,735	H809Q	probably benign	Het
Eprs	G	A	1: 185,379,742		probably null	Het
Gdf7	A	G	12: 8,298,050	S416P	probably damaging	Het
Ints8	T	C	4: 11,225,725	M611V	probably benign	Het
Micalcl	A	G	7: 112,394,795	E504G	probably damaging	Het
Nr1h3	T	C	2: 91,190,220	D256G	probably benign	Het
Pramel5	T	C	4: 144,273,740	M89V	probably benign	Het
Psg18	T	C	7: 18,346,119	T386A	probably benign	Het
Ptprc	A	G	1: 138,066,152	V1180A	possibly damaging	Het
Rassf8	T	C	6: 145,815,334	S129P	probably damaging	Het
Rbm6	A	G	9: 107,779,597	Y994H	probably damaging	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Slc2a4	A	G	11: 69,945,625	F222S	possibly damaging	Het
Smarca2	T	C	19: 26,691,454		probably null	Het
Tmtc4	T	G	14: 122,971,903	N110T	probably damaging	Het
Tsc22d1	TCAGCAGCAGCAGCAGCAGCAGCAGCA	TCAGCAGCAGCAGCAGCAGCAGCA	14: 76,417,267		probably benign	Het
Umad1	T	A	6: 8,427,078	D110E	probably damaging	Het
Ylpm1	A	G	12: 85,014,117		probably benign	Het

Other mutations in Mrps30

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01647:Mrps30	APN	13	118380610	missense	probably damaging	1.00
R0030:Mrps30	UTSW	13	118382995	missense	possibly damaging	0.94
R2764:Mrps30	UTSW	13	118384588	missense	probably benign	0.03
R4030:Mrps30	UTSW	13	118380541	missense	probably damaging	1.00
R4231:Mrps30	UTSW	13	118386840	missense	probably damaging	0.98
R4232:Mrps30	UTSW	13	118386840	missense	probably damaging	0.98
R4234:Mrps30	UTSW	13	118386840	missense	probably damaging	0.98
R4235:Mrps30	UTSW	13	118386840	missense	probably damaging	0.98
R4236:Mrps30	UTSW	13	118386840	missense	probably damaging	0.98
R4625:Mrps30	UTSW	13	118386714	missense	probably benign	0.14
R4935:Mrps30	UTSW	13	118386895	missense	possibly damaging	0.82
R5363:Mrps30	UTSW	13	118387162	missense	probably benign	0.39
R5986:Mrps30	UTSW	13	118384565	critical splice donor site	probably null
R6566:Mrps30	UTSW	13	118387126	missense	probably benign	0.00
R6681:Mrps30	UTSW	13	118380598	missense	probably damaging	0.98
R6694:Mrps30	UTSW	13	118386961	missense	possibly damaging	0.82
R6699:Mrps30	UTSW	13	118380598	missense	probably damaging	0.98
R6700:Mrps30	UTSW	13	118380598	missense	probably damaging	0.98
R6788:Mrps30	UTSW	13	118380372	missense	probably benign	0.06
R8788:Mrps30	UTSW	13	118387002	missense	possibly damaging	0.86
R8905:Mrps30	UTSW	13	118386943	missense	probably benign
R8914:Mrps30	UTSW	13	118387219	missense	possibly damaging	0.52
R8927:Mrps30	UTSW	13	118386669	missense	probably damaging	1.00
R8928:Mrps30	UTSW	13	118386669	missense	probably damaging	1.00
R8930:Mrps30	UTSW	13	118387159	missense	probably benign
R8932:Mrps30	UTSW	13	118387159	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CATAACACTCCAAACTAGAGAGTTG -3'
(R):5'- TCTTAGACATGCTGCTCATCAC -3'

Sequencing Primer
(F):5'- TGAAAAAGACTTCCAGAAAAGTTGCC -3'
(R):5'- GACATGCTGCTCATCACATGTTTATG -3'

Posted On

2014-11-12