Mutagenetix > Incidental Mutations

Incidental Mutation 'R2439:Tsc22d1'

249741

Institutional Source

Beutler Lab

Gene Symbol

Tsc22d1

Ensembl Gene

ENSMUSG00000022010

Gene Name

TSC22 domain family, member 1

Synonyms

TSC-22, Tgfb1i4, Egr5

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.280) question?

Stock #

R2439 (G1)

Quality Score

105

Status

Not validated

Chromosome

Chromosomal Location

76414961-76507765 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

TCAGCAGCAGCAGCAGCAGCAGCAGCA to TCAGCAGCAGCAGCAGCAGCAGCA at 76417267 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134792 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048371] [ENSMUST00000110888] [ENSMUST00000175984] [ENSMUST00000176581] [ENSMUST00000176886] [ENSMUST00000177471]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000048371

SMART Domains

Protein: ENSMUSP00000044517
Gene: ENSMUSG00000022010

Domain	Start	End	E-Value	Type
low complexity region	32	47	N/A	INTRINSIC
low complexity region	59	96	N/A	INTRINSIC
low complexity region	121	132	N/A	INTRINSIC
low complexity region	191	208	N/A	INTRINSIC
low complexity region	216	241	N/A	INTRINSIC
low complexity region	246	257	N/A	INTRINSIC
low complexity region	266	289	N/A	INTRINSIC
low complexity region	461	489	N/A	INTRINSIC
low complexity region	497	521	N/A	INTRINSIC
low complexity region	537	556	N/A	INTRINSIC
low complexity region	619	637	N/A	INTRINSIC
low complexity region	673	687	N/A	INTRINSIC
low complexity region	702	724	N/A	INTRINSIC
low complexity region	933	970	N/A	INTRINSIC
Pfam:TSC22	992	1048	7e-31	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110888

SMART Domains

Protein: ENSMUSP00000106513
Gene: ENSMUSG00000022010

Domain	Start	End	E-Value	Type
low complexity region	32	47	N/A	INTRINSIC
low complexity region	59	96	N/A	INTRINSIC
low complexity region	121	132	N/A	INTRINSIC
low complexity region	191	208	N/A	INTRINSIC
low complexity region	216	241	N/A	INTRINSIC
low complexity region	246	257	N/A	INTRINSIC
low complexity region	266	289	N/A	INTRINSIC
low complexity region	379	407	N/A	INTRINSIC
low complexity region	415	439	N/A	INTRINSIC
low complexity region	455	474	N/A	INTRINSIC
internal_repeat_1	502	536	8.43e-5	PROSPERO
low complexity region	537	555	N/A	INTRINSIC
low complexity region	591	605	N/A	INTRINSIC
low complexity region	620	642	N/A	INTRINSIC
internal_repeat_1	644	676	8.43e-5	PROSPERO
low complexity region	851	888	N/A	INTRINSIC
Pfam:TSC22	910	969	4.7e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000175984

SMART Domains

Protein: ENSMUSP00000135307
Gene: ENSMUSG00000022010

Domain	Start	End	E-Value	Type
low complexity region	77	114	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176581

SMART Domains

Protein: ENSMUSP00000135789
Gene: ENSMUSG00000022010

Domain	Start	End	E-Value	Type
low complexity region	78	115	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176886

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177333

Predicted Effect

probably benign
Transcript: ENSMUST00000177471

SMART Domains

Protein: ENSMUSP00000134792
Gene: ENSMUSG00000022010

Domain	Start	End	E-Value	Type
low complexity region	18	55	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TSC22 domain family of leucine zipper transcription factors. The encoded protein is stimulated by transforming growth factor beta, and regulates the transcription of multiple genes including C-type natriuretic peptide. The encoded protein may play a critical role in tumor suppression through the induction of cancer cell apoptosis, and a single nucleotide polymorphism in the promoter of this gene has been associated with diabetic nephropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mcie homozygous for a null allele exhibit increased proliferation of bone marrow cells and decreased kidney and heart weights. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210407C18Rik	A	G	11: 58,610,777	C127R	probably damaging	Het
Atp11b	C	A	3: 35,814,084	T635K	possibly damaging	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Btla	G	T	16: 45,239,140	C69F	probably damaging	Het
Cdh10	T	G	15: 19,013,398	L695V	probably damaging	Het
Cfap44	C	T	16: 44,481,246		probably benign	Het
Dock10	T	G	1: 80,532,432	N1560H	probably damaging	Het
Ephb6	C	A	6: 41,618,735	H809Q	probably benign	Het
Eprs	G	A	1: 185,379,742		probably null	Het
Gdf7	A	G	12: 8,298,050	S416P	probably damaging	Het
Ints8	T	C	4: 11,225,725	M611V	probably benign	Het
Micalcl	A	G	7: 112,394,795	E504G	probably damaging	Het
Mrps30	G	A	13: 118,385,272	P231S	probably damaging	Het
Nr1h3	T	C	2: 91,190,220	D256G	probably benign	Het
Pramel5	T	C	4: 144,273,740	M89V	probably benign	Het
Psg18	T	C	7: 18,346,119	T386A	probably benign	Het
Ptprc	A	G	1: 138,066,152	V1180A	possibly damaging	Het
Rassf8	T	C	6: 145,815,334	S129P	probably damaging	Het
Rbm6	A	G	9: 107,779,597	Y994H	probably damaging	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Slc2a4	A	G	11: 69,945,625	F222S	possibly damaging	Het
Smarca2	T	C	19: 26,691,454		probably null	Het
Tmtc4	T	G	14: 122,971,903	N110T	probably damaging	Het
Umad1	T	A	6: 8,427,078	D110E	probably damaging	Het
Ylpm1	A	G	12: 85,014,117		probably benign	Het

Other mutations in Tsc22d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Tsc22d1	APN	14	76418917	missense	probably damaging	0.99
IGL00515:Tsc22d1	APN	14	76418477	missense	probably damaging	0.99
IGL00703:Tsc22d1	APN	14	76504828	missense	possibly damaging	0.62
IGL00974:Tsc22d1	APN	14	76506442	missense	probably damaging	1.00
IGL01015:Tsc22d1	APN	14	76418741	missense	possibly damaging	0.66
IGL01515:Tsc22d1	APN	14	76505299	critical splice donor site	probably null
IGL02172:Tsc22d1	APN	14	76417692	missense	probably benign	0.04
IGL02307:Tsc22d1	APN	14	76416461	missense	probably damaging	0.99
IGL02553:Tsc22d1	APN	14	76417398	missense	possibly damaging	0.73
IGL02870:Tsc22d1	APN	14	76417617	missense	probably benign	0.42
IGL02989:Tsc22d1	APN	14	76418901	missense	probably benign	0.05
IGL03216:Tsc22d1	APN	14	76418637	missense	probably benign	0.02
R0127:Tsc22d1	UTSW	14	76418981	missense	possibly damaging	0.92
R0416:Tsc22d1	UTSW	14	76505303	splice site	probably benign
R0854:Tsc22d1	UTSW	14	76418201	nonsense	probably null
R0963:Tsc22d1	UTSW	14	76418599	missense	possibly damaging	0.92
R1370:Tsc22d1	UTSW	14	76437664	intron	probably benign
R1736:Tsc22d1	UTSW	14	76418357	missense	probably benign	0.08
R1751:Tsc22d1	UTSW	14	76418102	missense	probably damaging	0.98
R1760:Tsc22d1	UTSW	14	76416948	missense	possibly damaging	0.69
R1767:Tsc22d1	UTSW	14	76418102	missense	probably damaging	0.98
R2020:Tsc22d1	UTSW	14	76418333	missense	probably damaging	1.00
R2209:Tsc22d1	UTSW	14	76418740	missense	probably damaging	1.00
R2471:Tsc22d1	UTSW	14	76418204	missense	probably benign	0.00
R3114:Tsc22d1	UTSW	14	76417337	missense	probably damaging	1.00
R3907:Tsc22d1	UTSW	14	76416543	missense	probably damaging	0.98
R3973:Tsc22d1	UTSW	14	76418609	missense	probably damaging	1.00
R3974:Tsc22d1	UTSW	14	76418609	missense	probably damaging	1.00
R3975:Tsc22d1	UTSW	14	76418609	missense	probably damaging	1.00
R3976:Tsc22d1	UTSW	14	76418609	missense	probably damaging	1.00
R4292:Tsc22d1	UTSW	14	76418880	missense	probably benign	0.12
R4612:Tsc22d1	UTSW	14	76419005	missense	possibly damaging	0.66
R4806:Tsc22d1	UTSW	14	76416988	splice site	probably null
R4980:Tsc22d1	UTSW	14	76418256	missense	probably benign	0.02
R5068:Tsc22d1	UTSW	14	76418310	missense	probably benign	0.44
R5070:Tsc22d1	UTSW	14	76418310	missense	probably benign	0.44
R5239:Tsc22d1	UTSW	14	76418412	missense	probably damaging	0.99
R5360:Tsc22d1	UTSW	14	76417267	unclassified	probably benign
R5400:Tsc22d1	UTSW	14	76417054	missense	probably benign	0.00
R5616:Tsc22d1	UTSW	14	76416217	unclassified	probably benign
R5726:Tsc22d1	UTSW	14	76505317	nonsense	probably null
R5934:Tsc22d1	UTSW	14	76418826	missense	possibly damaging	0.87
R6860:Tsc22d1	UTSW	14	76418292	missense	possibly damaging	0.73
R6904:Tsc22d1	UTSW	14	76506483	nonsense	probably null
R7016:Tsc22d1	UTSW	14	76417542	missense	probably damaging	1.00
R7274:Tsc22d1	UTSW	14	76416714	missense	probably damaging	0.98
R7482:Tsc22d1	UTSW	14	76418487	missense	probably benign	0.10
R7532:Tsc22d1	UTSW	14	76416046	unclassified	probably benign
R7536:Tsc22d1	UTSW	14	76504763	missense	probably benign	0.00
R7784:Tsc22d1	UTSW	14	76416701	nonsense	probably null
R8161:Tsc22d1	UTSW	14	76417020	missense	probably benign	0.02
R8405:Tsc22d1	UTSW	14	76418294	missense	probably damaging	1.00
R8963:Tsc22d1	UTSW	14	76418826	missense	probably benign	0.06
R9150:Tsc22d1	UTSW	14	76416616	missense	probably damaging	0.99
R9259:Tsc22d1	UTSW	14	76417044	missense	probably damaging	1.00
R9431:Tsc22d1	UTSW	14	76417267	unclassified	probably benign
R9439:Tsc22d1	UTSW	14	76506459	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTGTGGGTAGTTTCAGTCCC -3'
(R):5'- GTCTCCACCACTTTATTGACGG -3'

Sequencing Primer
(F):5'- TTTCAGTCCCAGTGTGACGAACAG -3'
(R):5'- ACTTTATTGACGGCCACGC -3'

Posted On

2014-11-12