Incidental Mutation 'R2439:Tmtc4'
ID 249742
Institutional Source Beutler Lab
Gene Symbol Tmtc4
Ensembl Gene ENSMUSG00000041594
Gene Name transmembrane and tetratricopeptide repeat containing 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2439 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 122918971-122984035 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 122971903 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 110 (N110T)
Ref Sequence ENSEMBL: ENSMUSP00000116480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037726] [ENSMUST00000126867] [ENSMUST00000128969] [ENSMUST00000143189] [ENSMUST00000148661]
AlphaFold Q8BG19
Predicted Effect probably damaging
Transcript: ENSMUST00000037726
AA Change: N110T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046368
Gene: ENSMUSG00000041594
AA Change: N110T

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 191 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
transmembrane domain 227 249 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
Pfam:DUF1736 290 369 3e-35 PFAM
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
TPR 482 515 2.49e-5 SMART
TPR 516 549 9.03e-3 SMART
TPR 550 583 2.49e-5 SMART
TPR 584 617 2.63e-4 SMART
TPR 618 651 5.78e-1 SMART
TPR 652 685 2.19e-1 SMART
TPR 686 719 1.37e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126867
AA Change: N110T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116379
Gene: ENSMUSG00000041594
AA Change: N110T

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 191 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
transmembrane domain 227 249 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
Pfam:DUF1736 290 369 3e-35 PFAM
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
TPR 482 515 2.49e-5 SMART
TPR 516 549 9.03e-3 SMART
TPR 550 583 2.49e-5 SMART
TPR 584 617 2.63e-4 SMART
TPR 618 651 5.78e-1 SMART
TPR 652 685 2.19e-1 SMART
TPR 686 719 1.37e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135917
Predicted Effect probably damaging
Transcript: ENSMUST00000143189
AA Change: N110T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116480
Gene: ENSMUSG00000041594
AA Change: N110T

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 100 122 N/A INTRINSIC
transmembrane domain 165 187 N/A INTRINSIC
transmembrane domain 200 219 N/A INTRINSIC
transmembrane domain 224 246 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000148661
AA Change: N110T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121523
Gene: ENSMUSG00000041594
AA Change: N110T

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 191 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
transmembrane domain 227 249 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
Pfam:DUF1736 292 366 4.4e-36 PFAM
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
TPR 482 515 2.49e-5 SMART
TPR 516 549 9.03e-3 SMART
TPR 550 583 2.49e-5 SMART
TPR 584 617 2.63e-4 SMART
TPR 618 651 5.78e-1 SMART
TPR 652 685 2.19e-1 SMART
TPR 686 719 1.37e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228552
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A G 11: 58,610,777 C127R probably damaging Het
Atp11b C A 3: 35,814,084 T635K possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Btla G T 16: 45,239,140 C69F probably damaging Het
Cdh10 T G 15: 19,013,398 L695V probably damaging Het
Cfap44 C T 16: 44,481,246 probably benign Het
Dock10 T G 1: 80,532,432 N1560H probably damaging Het
Ephb6 C A 6: 41,618,735 H809Q probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Gdf7 A G 12: 8,298,050 S416P probably damaging Het
Ints8 T C 4: 11,225,725 M611V probably benign Het
Micalcl A G 7: 112,394,795 E504G probably damaging Het
Mrps30 G A 13: 118,385,272 P231S probably damaging Het
Nr1h3 T C 2: 91,190,220 D256G probably benign Het
Pramel5 T C 4: 144,273,740 M89V probably benign Het
Psg18 T C 7: 18,346,119 T386A probably benign Het
Ptprc A G 1: 138,066,152 V1180A possibly damaging Het
Rassf8 T C 6: 145,815,334 S129P probably damaging Het
Rbm6 A G 9: 107,779,597 Y994H probably damaging Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Slc2a4 A G 11: 69,945,625 F222S possibly damaging Het
Smarca2 T C 19: 26,691,454 probably null Het
Tsc22d1 TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA 14: 76,417,267 probably benign Het
Umad1 T A 6: 8,427,078 D110E probably damaging Het
Ylpm1 A G 12: 85,014,117 probably benign Het
Other mutations in Tmtc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Tmtc4 APN 14 122925954 splice site probably benign
IGL01408:Tmtc4 APN 14 122925954 splice site probably benign
IGL01487:Tmtc4 APN 14 122926031 missense probably benign 0.25
IGL01694:Tmtc4 APN 14 122973212 missense possibly damaging 0.92
IGL01934:Tmtc4 APN 14 122927635 nonsense probably null
IGL02456:Tmtc4 APN 14 122925962 critical splice donor site probably null
IGL03116:Tmtc4 APN 14 122927632 missense probably benign 0.02
IGL03326:Tmtc4 APN 14 122945540 missense probably damaging 0.99
PIT4403001:Tmtc4 UTSW 14 122973229 missense probably benign 0.01
R0344:Tmtc4 UTSW 14 122978160 missense probably damaging 1.00
R0630:Tmtc4 UTSW 14 122926090 splice site probably benign
R0849:Tmtc4 UTSW 14 122945554 missense possibly damaging 0.62
R1129:Tmtc4 UTSW 14 122943153 critical splice donor site probably null
R1601:Tmtc4 UTSW 14 122944826 missense probably benign 0.01
R1835:Tmtc4 UTSW 14 122941988 critical splice acceptor site probably null
R1966:Tmtc4 UTSW 14 122927599 missense probably benign 0.31
R2024:Tmtc4 UTSW 14 122921265 missense probably benign 0.02
R2025:Tmtc4 UTSW 14 122921265 missense probably benign 0.02
R2026:Tmtc4 UTSW 14 122921265 missense probably benign 0.02
R2027:Tmtc4 UTSW 14 122921265 missense probably benign 0.02
R2256:Tmtc4 UTSW 14 122941408 missense probably benign 0.09
R3001:Tmtc4 UTSW 14 122932818 critical splice donor site probably null
R3002:Tmtc4 UTSW 14 122932818 critical splice donor site probably null
R3894:Tmtc4 UTSW 14 122921319 splice site probably null
R4561:Tmtc4 UTSW 14 122963298 missense probably benign 0.21
R4926:Tmtc4 UTSW 14 122973206 missense probably damaging 1.00
R5000:Tmtc4 UTSW 14 122933331 missense possibly damaging 0.46
R5024:Tmtc4 UTSW 14 122941302 splice site probably null
R5104:Tmtc4 UTSW 14 122932845 missense probably damaging 0.99
R5200:Tmtc4 UTSW 14 122945557 missense probably benign 0.05
R5536:Tmtc4 UTSW 14 122932879 missense probably benign 0.09
R5677:Tmtc4 UTSW 14 122950499 missense probably damaging 1.00
R5768:Tmtc4 UTSW 14 122933153 missense possibly damaging 0.91
R6467:Tmtc4 UTSW 14 122925979 missense possibly damaging 0.80
R7317:Tmtc4 UTSW 14 122978181 missense probably benign 0.00
R7516:Tmtc4 UTSW 14 122943323 missense possibly damaging 0.68
R7539:Tmtc4 UTSW 14 122978289 splice site probably null
R7584:Tmtc4 UTSW 14 122978151 missense probably benign 0.01
R7821:Tmtc4 UTSW 14 122971877 missense probably benign
R7903:Tmtc4 UTSW 14 122927648 missense probably benign 0.00
R8969:Tmtc4 UTSW 14 122941812 splice site probably benign
R9239:Tmtc4 UTSW 14 122927666 missense possibly damaging 0.81
R9381:Tmtc4 UTSW 14 122926029 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTGTGGGCGATACTTACAC -3'
(R):5'- GACTTTGGACTCTATCGGTGC -3'

Sequencing Primer
(F):5'- TGTGGGCGATACTTACACACTCAG -3'
(R):5'- GGACTCTATCGGTGCCCTTTTC -3'
Posted On 2014-11-12