Incidental Mutation 'R2439:Btla'
ID 249744
Institutional Source Beutler Lab
Gene Symbol Btla
Ensembl Gene ENSMUSG00000052013
Gene Name B and T lymphocyte associated
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R2439 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 45224315-45257670 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 45239140 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 69 (C69F)
Ref Sequence ENSEMBL: ENSMUSP00000099866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063654] [ENSMUST00000102802]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000063654
AA Change: C69F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067877
Gene: ENSMUSG00000052013
AA Change: C69F

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IG 49 143 2.92e-5 SMART
transmembrane domain 182 204 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102802
AA Change: C69F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099866
Gene: ENSMUSG00000052013
AA Change: C69F

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IG 49 143 2.92e-5 SMART
transmembrane domain 181 203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded protein contains a single immunoglobulin (Ig) domain and is a receptor that relays inhibitory signals to suppress the immune response. Alternative splicing results in multiple transcript variants. Polymorphisms in this gene have been associated with an increased risk of rheumatoid arthritis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Targeted inactivation of this gene leads to increased T cell activation. Homozygotes for a null allele show altered peripheral T cell anergy. Homozygotes for a different null allele show enhanced specific antibody responses, increased susceptibility to EAE, and prolonged allograft survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A G 11: 58,610,777 C127R probably damaging Het
Atp11b C A 3: 35,814,084 T635K possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cdh10 T G 15: 19,013,398 L695V probably damaging Het
Cfap44 C T 16: 44,481,246 probably benign Het
Dock10 T G 1: 80,532,432 N1560H probably damaging Het
Ephb6 C A 6: 41,618,735 H809Q probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Gdf7 A G 12: 8,298,050 S416P probably damaging Het
Ints8 T C 4: 11,225,725 M611V probably benign Het
Micalcl A G 7: 112,394,795 E504G probably damaging Het
Mrps30 G A 13: 118,385,272 P231S probably damaging Het
Nr1h3 T C 2: 91,190,220 D256G probably benign Het
Pramel5 T C 4: 144,273,740 M89V probably benign Het
Psg18 T C 7: 18,346,119 T386A probably benign Het
Ptprc A G 1: 138,066,152 V1180A possibly damaging Het
Rassf8 T C 6: 145,815,334 S129P probably damaging Het
Rbm6 A G 9: 107,779,597 Y994H probably damaging Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Slc2a4 A G 11: 69,945,625 F222S possibly damaging Het
Smarca2 T C 19: 26,691,454 probably null Het
Tmtc4 T G 14: 122,971,903 N110T probably damaging Het
Tsc22d1 TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA 14: 76,417,267 probably benign Het
Umad1 T A 6: 8,427,078 D110E probably damaging Het
Ylpm1 A G 12: 85,014,117 probably benign Het
Other mutations in Btla
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Btla APN 16 45250353 missense probably benign 0.34
IGL01774:Btla APN 16 45250548 missense possibly damaging 0.78
IGL03252:Btla APN 16 45239146 missense possibly damaging 0.56
IGL03266:Btla APN 16 45239275 missense probably damaging 0.98
Conundrum UTSW 16 45239298 missense probably damaging 1.00
Enigmatic UTSW 16 45239039 splice site probably null
Mysterious UTSW 16 45250573 nonsense probably null
R1373:Btla UTSW 16 45224420 missense probably benign 0.09
R1864:Btla UTSW 16 45250374 missense probably damaging 0.97
R4133:Btla UTSW 16 45239298 missense probably damaging 1.00
R4193:Btla UTSW 16 45250482 missense probably benign 0.00
R4948:Btla UTSW 16 45242728 missense probably benign 0.33
R5597:Btla UTSW 16 45244236 missense probably benign
R5666:Btla UTSW 16 45250419 missense probably damaging 1.00
R5670:Btla UTSW 16 45250419 missense probably damaging 1.00
R5700:Btla UTSW 16 45250573 nonsense probably null
R5859:Btla UTSW 16 45239039 splice site probably null
R6442:Btla UTSW 16 45224458 missense probably benign 0.00
R6442:Btla UTSW 16 45250350 missense possibly damaging 0.82
R6526:Btla UTSW 16 45239094 missense probably damaging 1.00
R6883:Btla UTSW 16 45242729 missense probably benign 0.09
R8016:Btla UTSW 16 45250587 missense probably damaging 0.99
R8098:Btla UTSW 16 45244249 nonsense probably null
R8803:Btla UTSW 16 45239067 missense probably benign 0.06
R9091:Btla UTSW 16 45244293 missense possibly damaging 0.72
R9270:Btla UTSW 16 45244293 missense possibly damaging 0.72
R9388:Btla UTSW 16 45239091 missense probably damaging 1.00
Z1176:Btla UTSW 16 45239358 missense probably damaging 0.98
Z1177:Btla UTSW 16 45239272 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACCACACTGGAATACTGAAGG -3'
(R):5'- AGTTTGTAGAACAGCTATACGACCC -3'

Sequencing Primer
(F):5'- CCACACTGGAATACTGAAGGTAAAG -3'
(R):5'- TACGACCCATTATCACTGAGATG -3'
Posted On 2014-11-12