Incidental Mutation 'R2440:Tyrp1'
ID249755
Institutional Source Beutler Lab
Gene Symbol Tyrp1
Ensembl Gene ENSMUSG00000005994
Gene Nametyrosinase-related protein 1
SynonymsTyrp, isa, Oca3, TRP1, TRP-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R2440 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location80834123-80851719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 80846606 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 7 (V7I)
Ref Sequence ENSEMBL: ENSMUSP00000119167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006151] [ENSMUST00000102831] [ENSMUST00000133932]
Predicted Effect probably benign
Transcript: ENSMUST00000006151
AA Change: V373I

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000006151
Gene: ENSMUSG00000005994
AA Change: V373I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Tyrosinase 182 417 1.7e-37 PFAM
transmembrane domain 479 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102831
AA Change: V373I

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099895
Gene: ENSMUSG00000005994
AA Change: V373I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Tyrosinase 182 417 4.9e-38 PFAM
transmembrane domain 479 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133932
AA Change: V7I

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119167
Gene: ENSMUSG00000005994
AA Change: V7I

DomainStartEndE-ValueType
Pfam:Tyrosinase 1 51 1e-12 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a melanosomal enzyme that belongs to the tyrosinase family and plays an important role in the melanin biosynthetic pathway. Defects in this gene are the cause of rufous oculocutaneous albinism and oculocutaneous albinism type III. [provided by RefSeq, Mar 2009]
PHENOTYPE: The major influence of mutations at this locus is to change eumelanin from a black to a brown pigment in the coat and eyes in varying degrees. Semidominant mutants result in melanocyte degeneration causing reduced pigmentation and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik T C 15: 60,016,280 T104A probably benign Het
5830473C10Rik A G 5: 90,572,689 probably null Het
Adar A G 3: 89,734,854 H14R possibly damaging Het
Alcam T A 16: 52,305,613 M114L probably damaging Het
Cntn5 A G 9: 10,171,955 Y75H possibly damaging Het
Coch T C 12: 51,596,562 S122P probably damaging Het
Cyp2c69 T C 19: 39,876,294 K247E probably benign Het
Gm1527 A G 3: 28,895,615 D8G probably damaging Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Itga8 G A 2: 12,178,680 T751I possibly damaging Het
Kif5a A G 10: 127,231,336 V904A probably benign Het
Lpgat1 A G 1: 191,760,209 E269G probably benign Het
Olfr536 T A 7: 140,503,552 K302N probably benign Het
Pde4d A G 13: 109,927,197 probably benign Het
Rita1 T C 5: 120,609,939 Y98C probably damaging Het
Surf1 A G 2: 26,913,907 probably null Het
Sv2c A G 13: 96,048,576 Y198H probably damaging Het
Svs3a T C 2: 164,289,631 F41L possibly damaging Het
Tigd2 A G 6: 59,209,995 probably benign Het
Tubb4a C A 17: 57,086,285 G38W probably damaging Het
Unc45a A G 7: 80,329,057 Y615H probably damaging Het
Wisp1 T A 15: 66,912,857 D126E possibly damaging Het
Other mutations in Tyrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Tyrp1 APN 4 80840765 missense possibly damaging 0.95
IGL01586:Tyrp1 APN 4 80844898 missense probably benign 0.00
IGL01620:Tyrp1 APN 4 80844802 nonsense probably null
IGL02126:Tyrp1 APN 4 80837608 nonsense probably null
IGL02174:Tyrp1 APN 4 80844826 nonsense probably null
IGL02601:Tyrp1 APN 4 80840775 missense probably null 0.00
IGL02630:Tyrp1 APN 4 80840757 missense possibly damaging 0.95
butter UTSW 4 80840806 critical splice donor site probably null
ca-los UTSW 4 80844868 nonsense probably null
chi UTSW 4 80840778 missense probably damaging 1.00
R0011:Tyrp1 UTSW 4 80840793 missense probably damaging 1.00
R0011:Tyrp1 UTSW 4 80840793 missense probably damaging 1.00
R0145:Tyrp1 UTSW 4 80840778 missense probably damaging 1.00
R1172:Tyrp1 UTSW 4 80844868 nonsense probably null
R1173:Tyrp1 UTSW 4 80844868 nonsense probably null
R1175:Tyrp1 UTSW 4 80844868 nonsense probably null
R1886:Tyrp1 UTSW 4 80840806 critical splice donor site probably null
R2099:Tyrp1 UTSW 4 80835379 missense possibly damaging 0.69
R2273:Tyrp1 UTSW 4 80837534 missense probably damaging 0.99
R2274:Tyrp1 UTSW 4 80837534 missense probably damaging 0.99
R2275:Tyrp1 UTSW 4 80837534 missense probably damaging 0.99
R2312:Tyrp1 UTSW 4 80837564 nonsense probably null
R2427:Tyrp1 UTSW 4 80850871 missense probably benign 0.00
R2915:Tyrp1 UTSW 4 80837455 missense possibly damaging 0.46
R4343:Tyrp1 UTSW 4 80849841 missense possibly damaging 0.92
R4512:Tyrp1 UTSW 4 80837512 missense probably damaging 1.00
R4703:Tyrp1 UTSW 4 80840806 critical splice donor site probably null
R4732:Tyrp1 UTSW 4 80844935 missense possibly damaging 0.67
R4733:Tyrp1 UTSW 4 80844935 missense possibly damaging 0.67
R4788:Tyrp1 UTSW 4 80844943 nonsense probably null
R4834:Tyrp1 UTSW 4 80846596 nonsense probably null
R4911:Tyrp1 UTSW 4 80850907 utr 3 prime probably benign
R4938:Tyrp1 UTSW 4 80840646 missense probably damaging 1.00
R5129:Tyrp1 UTSW 4 80846607 missense probably damaging 1.00
R5154:Tyrp1 UTSW 4 80850717 missense probably benign 0.00
R6249:Tyrp1 UTSW 4 80850772 missense possibly damaging 0.93
R6492:Tyrp1 UTSW 4 80840781 missense probably null 1.00
R6617:Tyrp1 UTSW 4 80846747 missense probably benign 0.24
R6870:Tyrp1 UTSW 4 80850777 missense probably benign 0.37
R6990:Tyrp1 UTSW 4 80835437 missense probably damaging 1.00
R7275:Tyrp1 UTSW 4 80837584 missense possibly damaging 0.78
R7684:Tyrp1 UTSW 4 80840625 missense probably damaging 1.00
R7980:Tyrp1 UTSW 4 80840627 missense probably damaging 1.00
R8001:Tyrp1 UTSW 4 80840670 missense probably benign 0.10
R8051:Tyrp1 UTSW 4 80837660 missense probably damaging 1.00
R8233:Tyrp1 UTSW 4 80850953 missense unknown
R8326:Tyrp1 UTSW 4 80850684 missense probably benign 0.06
Z1176:Tyrp1 UTSW 4 80844889 nonsense probably null
Z1177:Tyrp1 UTSW 4 80849817 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGCTCTAGAGAGGCAACAC -3'
(R):5'- TGTCAAGGGCTAGCTTGAATTG -3'

Sequencing Primer
(F):5'- GGCAACACTGTTATAATGAGCTG -3'
(R):5'- GGTAAGCTCTTTGCAAAGCC -3'
Posted On2014-11-12