Incidental Mutation 'R2440:Gpat3'
ID249757
Institutional Source Beutler Lab
Gene Symbol Gpat3
Ensembl Gene ENSMUSG00000029314
Gene Nameglycerol-3-phosphate acyltransferase 3
SynonymsAgpat9, 4933407I02Rik, A230097K15Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R2440 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location100845713-100899102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100857173 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 58 (P58L)
Ref Sequence ENSEMBL: ENSMUSP00000108508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031255] [ENSMUST00000092990] [ENSMUST00000112887]
Predicted Effect probably benign
Transcript: ENSMUST00000031255
AA Change: P58L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031255
Gene: ENSMUSG00000029314
AA Change: P58L

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Blast:PlsC 99 160 7e-6 BLAST
low complexity region 166 177 N/A INTRINSIC
PlsC 223 334 5.96e-22 SMART
Blast:PlsC 348 396 2e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000092990
AA Change: P58L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090667
Gene: ENSMUSG00000029314
AA Change: P58L

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Blast:PlsC 99 160 7e-6 BLAST
low complexity region 166 177 N/A INTRINSIC
PlsC 223 334 5.96e-22 SMART
Blast:PlsC 348 396 2e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112887
AA Change: P58L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108508
Gene: ENSMUSG00000029314
AA Change: P58L

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Blast:PlsC 99 160 7e-6 BLAST
low complexity region 166 177 N/A INTRINSIC
PlsC 223 334 5.96e-22 SMART
Blast:PlsC 348 396 2e-22 BLAST
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lysophosphatidic acid acyltransferase protein family. The encoded protein is an enzyme which catalyzes the conversion of glycerol-3-phosphate to lysophosphatidic acid in the synthesis of triacylglycerol. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2012]
PHENOTYPE: Under high-fat feeding, mice homozygous for a knock-out allele exhibit increased energy expenditure, improved glucose homeostasis, enlarged livers, increased total serum cholesterol levels, altered liver cholesterol metabolism, and female-specific protection from diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik T C 15: 60,016,280 T104A probably benign Het
5830473C10Rik A G 5: 90,572,689 probably null Het
Adar A G 3: 89,734,854 H14R possibly damaging Het
Alcam T A 16: 52,305,613 M114L probably damaging Het
Cntn5 A G 9: 10,171,955 Y75H possibly damaging Het
Coch T C 12: 51,596,562 S122P probably damaging Het
Cyp2c69 T C 19: 39,876,294 K247E probably benign Het
Gm1527 A G 3: 28,895,615 D8G probably damaging Het
Itga8 G A 2: 12,178,680 T751I possibly damaging Het
Kif5a A G 10: 127,231,336 V904A probably benign Het
Lpgat1 A G 1: 191,760,209 E269G probably benign Het
Olfr536 T A 7: 140,503,552 K302N probably benign Het
Pde4d A G 13: 109,927,197 probably benign Het
Rita1 T C 5: 120,609,939 Y98C probably damaging Het
Surf1 A G 2: 26,913,907 probably null Het
Sv2c A G 13: 96,048,576 Y198H probably damaging Het
Svs3a T C 2: 164,289,631 F41L possibly damaging Het
Tigd2 A G 6: 59,209,995 probably benign Het
Tubb4a C A 17: 57,086,285 G38W probably damaging Het
Tyrp1 G A 4: 80,846,606 V7I probably benign Het
Unc45a A G 7: 80,329,057 Y615H probably damaging Het
Wisp1 T A 15: 66,912,857 D126E possibly damaging Het
Other mutations in Gpat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Gpat3 APN 5 100893144 missense probably benign 0.01
R1429:Gpat3 UTSW 5 100893087 missense probably damaging 0.99
R1539:Gpat3 UTSW 5 100883388 missense probably benign 0.00
R1830:Gpat3 UTSW 5 100893180 missense probably benign
R2030:Gpat3 UTSW 5 100897821 missense probably benign
R2444:Gpat3 UTSW 5 100857173 missense probably benign
R3039:Gpat3 UTSW 5 100897805 missense possibly damaging 0.75
R3813:Gpat3 UTSW 5 100891639 splice site probably benign
R3830:Gpat3 UTSW 5 100884386 missense probably benign 0.02
R4636:Gpat3 UTSW 5 100857173 missense probably benign
R4637:Gpat3 UTSW 5 100857173 missense probably benign
R4679:Gpat3 UTSW 5 100893456 missense probably damaging 1.00
R4792:Gpat3 UTSW 5 100857173 missense probably benign
R5229:Gpat3 UTSW 5 100883424 missense probably damaging 1.00
R5661:Gpat3 UTSW 5 100885942 nonsense probably null
R6383:Gpat3 UTSW 5 100893144 missense probably benign 0.01
R8064:Gpat3 UTSW 5 100891656 missense probably benign 0.36
X0023:Gpat3 UTSW 5 100885960 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGTACATCAGAGGTTCCCTGG -3'
(R):5'- TCTGCATAGACCAACTTCCAATTG -3'

Sequencing Primer
(F):5'- ATCAGAGGTTCCCTGGGGTCTC -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On2014-11-12