Incidental Mutation 'R2440:Unc45a'
ID249760
Institutional Source Beutler Lab
Gene Symbol Unc45a
Ensembl Gene ENSMUSG00000030533
Gene Nameunc-45 myosin chaperone A
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2440 (G1)
Quality Score171
Status Not validated
Chromosome7
Chromosomal Location80325292-80341005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80329057 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 615 (Y615H)
Ref Sequence ENSEMBL: ENSMUSP00000102991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032748] [ENSMUST00000047362] [ENSMUST00000107368] [ENSMUST00000121882] [ENSMUST00000123189] [ENSMUST00000154428]
Predicted Effect probably damaging
Transcript: ENSMUST00000032748
AA Change: Y615H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032748
Gene: ENSMUSG00000030533
AA Change: Y615H

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 287 505 1.2e-43 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047362
SMART Domains Protein: ENSMUSP00000048043
Gene: ENSMUSG00000038930

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:RCC1 179 228 2.9e-17 PFAM
Pfam:RCC1_2 215 244 1.3e-10 PFAM
Pfam:RCC1 231 316 7.8e-9 PFAM
Pfam:RCC1_2 303 332 3.3e-10 PFAM
Pfam:RCC1 319 370 4.1e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107368
AA Change: Y615H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102991
Gene: ENSMUSG00000030533
AA Change: Y615H

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 314 505 2.4e-38 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121882
SMART Domains Protein: ENSMUSP00000113273
Gene: ENSMUSG00000038930

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:RCC1 179 228 7.4e-18 PFAM
Pfam:RCC1_2 216 244 5.5e-10 PFAM
Pfam:RCC1_2 304 332 6.2e-10 PFAM
Pfam:RCC1 319 370 1.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123109
Predicted Effect probably benign
Transcript: ENSMUST00000123189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148001
Predicted Effect silent
Transcript: ENSMUST00000154428
SMART Domains Protein: ENSMUSP00000119665
Gene: ENSMUSG00000030533

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 4e-9 BLAST
Blast:ARM 226 266 6e-8 BLAST
Pfam:UNC45-central 287 505 3.5e-44 PFAM
low complexity region 597 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205863
Predicted Effect probably benign
Transcript: ENSMUST00000206363
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UNC45A plays a role in cell proliferation and myoblast fusion, binds progesterone receptor (PGR; MIM 607311) and HSP90 (HSPCA; MIM 140571), and acts as a regulator of the progesterone receptor chaperoning pathway (Price et al., 2002 [PubMed 12356907]; Chadli et al., 2006 [PubMed 16478993]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik T C 15: 60,016,280 T104A probably benign Het
5830473C10Rik A G 5: 90,572,689 probably null Het
Adar A G 3: 89,734,854 H14R possibly damaging Het
Alcam T A 16: 52,305,613 M114L probably damaging Het
Cntn5 A G 9: 10,171,955 Y75H possibly damaging Het
Coch T C 12: 51,596,562 S122P probably damaging Het
Cyp2c69 T C 19: 39,876,294 K247E probably benign Het
Gm1527 A G 3: 28,895,615 D8G probably damaging Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Itga8 G A 2: 12,178,680 T751I possibly damaging Het
Kif5a A G 10: 127,231,336 V904A probably benign Het
Lpgat1 A G 1: 191,760,209 E269G probably benign Het
Olfr536 T A 7: 140,503,552 K302N probably benign Het
Pde4d A G 13: 109,927,197 probably benign Het
Rita1 T C 5: 120,609,939 Y98C probably damaging Het
Surf1 A G 2: 26,913,907 probably null Het
Sv2c A G 13: 96,048,576 Y198H probably damaging Het
Svs3a T C 2: 164,289,631 F41L possibly damaging Het
Tigd2 A G 6: 59,209,995 probably benign Het
Tubb4a C A 17: 57,086,285 G38W probably damaging Het
Tyrp1 G A 4: 80,846,606 V7I probably benign Het
Wisp1 T A 15: 66,912,857 D126E possibly damaging Het
Other mutations in Unc45a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02252:Unc45a APN 7 80332969 intron probably benign
IGL02266:Unc45a APN 7 80328486 missense probably damaging 0.96
IGL02383:Unc45a APN 7 80339662 nonsense probably null
IGL02959:Unc45a APN 7 80332973 intron probably benign
IGL03168:Unc45a APN 7 80333133 missense probably damaging 1.00
PIT4131001:Unc45a UTSW 7 80326361 missense possibly damaging 0.74
R0095:Unc45a UTSW 7 80329543 missense probably damaging 1.00
R0095:Unc45a UTSW 7 80329543 missense probably damaging 1.00
R0276:Unc45a UTSW 7 80326297 intron probably benign
R0373:Unc45a UTSW 7 80326344 missense probably damaging 0.97
R1827:Unc45a UTSW 7 80331740 missense possibly damaging 0.77
R2120:Unc45a UTSW 7 80340098 missense probably benign 0.29
R2442:Unc45a UTSW 7 80339669 missense probably damaging 1.00
R2508:Unc45a UTSW 7 80338875 missense probably benign
R3077:Unc45a UTSW 7 80338932 missense probably damaging 0.97
R3108:Unc45a UTSW 7 80331546 intron probably benign
R3109:Unc45a UTSW 7 80331546 intron probably benign
R3620:Unc45a UTSW 7 80334051 missense possibly damaging 0.84
R4471:Unc45a UTSW 7 80332980 missense possibly damaging 0.94
R4644:Unc45a UTSW 7 80328509 missense probably damaging 1.00
R4651:Unc45a UTSW 7 80333029 missense possibly damaging 0.93
R4838:Unc45a UTSW 7 80333035 missense probably damaging 1.00
R5234:Unc45a UTSW 7 80328799 missense probably benign 0.17
R5452:Unc45a UTSW 7 80329039 missense probably damaging 1.00
R5574:Unc45a UTSW 7 80334856 missense probably damaging 0.98
R5750:Unc45a UTSW 7 80334823 missense probably benign 0.17
R6169:Unc45a UTSW 7 80328763 missense possibly damaging 0.92
R6417:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6420:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6486:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6533:Unc45a UTSW 7 80334069 missense probably damaging 1.00
R6734:Unc45a UTSW 7 80336998 missense probably damaging 1.00
R6993:Unc45a UTSW 7 80325655 missense probably damaging 1.00
R7085:Unc45a UTSW 7 80326334 missense possibly damaging 0.87
R7180:Unc45a UTSW 7 80329821 splice site probably null
R7561:Unc45a UTSW 7 80331586 missense possibly damaging 0.63
R8079:Unc45a UTSW 7 80331562 missense probably damaging 1.00
R8395:Unc45a UTSW 7 80326332 missense probably benign 0.08
R8547:Unc45a UTSW 7 80326092 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TGGGAAAATGTGAGCTCTTCTC -3'
(R):5'- AGCAGGTTCCCAGTCTTTTC -3'

Sequencing Primer
(F):5'- CTCACAGAAGACATTGCTTAAAGG -3'
(R):5'- TGGGTTCCTCACAGATGGG -3'
Posted On2014-11-12