Incidental Mutation 'R2440:Sv2c'
ID 249765
Institutional Source Beutler Lab
Gene Symbol Sv2c
Ensembl Gene ENSMUSG00000051111
Gene Name synaptic vesicle glycoprotein 2c
Synonyms 4930527L09Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R2440 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 96091102-96269085 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 96185084 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 198 (Y198H)
Ref Sequence ENSEMBL: ENSMUSP00000138317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161263] [ENSMUST00000182289]
AlphaFold Q69ZS6
Predicted Effect probably damaging
Transcript: ENSMUST00000161263
AA Change: Y198H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124473
Gene: ENSMUSG00000051111
AA Change: Y198H

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 117 428 9.1e-31 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 573 4.8e-12 PFAM
Pfam:MFS_1 564 725 1.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182289
AA Change: Y198H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138317
Gene: ENSMUSG00000051111
AA Change: Y198H

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 119 427 2.2e-30 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 571 6.2e-15 PFAM
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik T C 15: 59,888,129 (GRCm39) T104A probably benign Het
Adar A G 3: 89,642,161 (GRCm39) H14R possibly damaging Het
Albfm1 A G 5: 90,720,548 (GRCm39) probably null Het
Alcam T A 16: 52,125,976 (GRCm39) M114L probably damaging Het
Ccn4 T A 15: 66,784,706 (GRCm39) D126E possibly damaging Het
Cntn5 A G 9: 10,171,960 (GRCm39) Y75H possibly damaging Het
Coch T C 12: 51,643,345 (GRCm39) S122P probably damaging Het
Cyp2c69 T C 19: 39,864,738 (GRCm39) K247E probably benign Het
Gm1527 A G 3: 28,949,764 (GRCm39) D8G probably damaging Het
Gpat3 C T 5: 101,005,039 (GRCm39) P58L probably benign Het
Itga8 G A 2: 12,183,491 (GRCm39) T751I possibly damaging Het
Kif5a A G 10: 127,067,205 (GRCm39) V904A probably benign Het
Lpgat1 A G 1: 191,492,321 (GRCm39) E269G probably benign Het
Or12j5 T A 7: 140,083,465 (GRCm39) K302N probably benign Het
Pde4d A G 13: 110,063,731 (GRCm39) probably benign Het
Rita1 T C 5: 120,748,004 (GRCm39) Y98C probably damaging Het
Surf1 A G 2: 26,803,919 (GRCm39) probably null Het
Svs3a T C 2: 164,131,551 (GRCm39) F41L possibly damaging Het
Tigd2 A G 6: 59,186,980 (GRCm39) probably benign Het
Tubb4a C A 17: 57,393,285 (GRCm39) G38W probably damaging Het
Tyrp1 G A 4: 80,764,843 (GRCm39) V7I probably benign Het
Unc45a A G 7: 79,978,805 (GRCm39) Y615H probably damaging Het
Other mutations in Sv2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Sv2c APN 13 96,184,937 (GRCm39) missense probably damaging 1.00
IGL01313:Sv2c APN 13 96,224,797 (GRCm39) missense probably damaging 1.00
IGL02710:Sv2c APN 13 96,125,649 (GRCm39) missense probably damaging 0.99
IGL02990:Sv2c APN 13 96,224,886 (GRCm39) missense probably damaging 1.00
IGL03145:Sv2c APN 13 96,125,606 (GRCm39) missense probably damaging 1.00
D4043:Sv2c UTSW 13 96,224,989 (GRCm39) missense probably benign 0.27
R0390:Sv2c UTSW 13 96,225,216 (GRCm39) missense probably benign
R0849:Sv2c UTSW 13 96,126,319 (GRCm39) missense probably damaging 1.00
R0907:Sv2c UTSW 13 96,224,763 (GRCm39) missense probably damaging 1.00
R1177:Sv2c UTSW 13 96,126,271 (GRCm39) missense possibly damaging 0.79
R1840:Sv2c UTSW 13 96,118,352 (GRCm39) missense probably benign 0.08
R1865:Sv2c UTSW 13 96,113,283 (GRCm39) missense probably benign 0.29
R1959:Sv2c UTSW 13 96,113,153 (GRCm39) missense probably damaging 1.00
R4007:Sv2c UTSW 13 96,123,341 (GRCm39) splice site probably benign
R4197:Sv2c UTSW 13 96,114,636 (GRCm39) missense probably damaging 1.00
R4697:Sv2c UTSW 13 96,122,526 (GRCm39) missense possibly damaging 0.64
R4719:Sv2c UTSW 13 96,123,319 (GRCm39) missense probably benign 0.21
R4822:Sv2c UTSW 13 96,122,457 (GRCm39) missense probably damaging 1.00
R5237:Sv2c UTSW 13 96,118,391 (GRCm39) missense possibly damaging 0.76
R5452:Sv2c UTSW 13 96,114,591 (GRCm39) missense probably damaging 1.00
R5531:Sv2c UTSW 13 96,097,886 (GRCm39) missense probably damaging 0.98
R5756:Sv2c UTSW 13 96,122,475 (GRCm39) missense probably benign
R5982:Sv2c UTSW 13 96,112,571 (GRCm39) nonsense probably null
R6220:Sv2c UTSW 13 96,113,134 (GRCm39) missense probably damaging 1.00
R6511:Sv2c UTSW 13 96,185,033 (GRCm39) missense probably benign 0.00
R6520:Sv2c UTSW 13 96,123,229 (GRCm39) missense probably benign
R7001:Sv2c UTSW 13 96,118,461 (GRCm39) missense probably benign 0.11
R7073:Sv2c UTSW 13 96,224,758 (GRCm39) missense probably damaging 1.00
R7116:Sv2c UTSW 13 96,113,152 (GRCm39) missense probably damaging 1.00
R7261:Sv2c UTSW 13 96,224,809 (GRCm39) missense probably damaging 1.00
R7374:Sv2c UTSW 13 96,125,644 (GRCm39) missense probably damaging 1.00
R7423:Sv2c UTSW 13 96,185,056 (GRCm39) missense probably benign 0.03
R7626:Sv2c UTSW 13 96,122,451 (GRCm39) missense probably benign 0.13
R7727:Sv2c UTSW 13 96,113,203 (GRCm39) missense possibly damaging 0.89
R7767:Sv2c UTSW 13 96,126,223 (GRCm39) missense probably damaging 1.00
R7818:Sv2c UTSW 13 96,123,328 (GRCm39) nonsense probably null
R7831:Sv2c UTSW 13 96,113,200 (GRCm39) missense probably damaging 1.00
R7991:Sv2c UTSW 13 96,224,797 (GRCm39) missense probably damaging 1.00
R8137:Sv2c UTSW 13 96,225,171 (GRCm39) missense probably damaging 0.96
R8254:Sv2c UTSW 13 96,225,073 (GRCm39) missense probably damaging 1.00
R9192:Sv2c UTSW 13 96,224,755 (GRCm39) missense probably benign 0.00
R9203:Sv2c UTSW 13 96,224,745 (GRCm39) nonsense probably null
R9278:Sv2c UTSW 13 96,112,589 (GRCm39) missense probably damaging 0.98
R9547:Sv2c UTSW 13 96,185,008 (GRCm39) missense probably benign 0.03
R9585:Sv2c UTSW 13 96,122,466 (GRCm39) missense probably benign
Z1176:Sv2c UTSW 13 96,112,605 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCTTCTTAGGCTGACACAG -3'
(R):5'- GCTGACTTTCCACCTGAGAAC -3'

Sequencing Primer
(F):5'- GCTTCTTAGGCTGACACAGAAATAG -3'
(R):5'- GACTTTCCACCTGAGAACTGAGTTC -3'
Posted On 2014-11-12