Incidental Mutation 'R2440:4933412E24Rik'
ID249766
Institutional Source Beutler Lab
Gene Symbol 4933412E24Rik
Ensembl Gene ENSMUSG00000071749
Gene NameRIKEN cDNA 4933412E24 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2440 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location60014866-60016613 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60016280 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 104 (T104A)
Ref Sequence ENSEMBL: ENSMUSP00000094154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096421]
Predicted Effect probably benign
Transcript: ENSMUST00000096421
AA Change: T104A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000094154
Gene: ENSMUSG00000071749
AA Change: T104A

DomainStartEndE-ValueType
Pfam:DUF4641 79 509 5.4e-189 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A G 5: 90,572,689 probably null Het
Adar A G 3: 89,734,854 H14R possibly damaging Het
Alcam T A 16: 52,305,613 M114L probably damaging Het
Cntn5 A G 9: 10,171,955 Y75H possibly damaging Het
Coch T C 12: 51,596,562 S122P probably damaging Het
Cyp2c69 T C 19: 39,876,294 K247E probably benign Het
Gm1527 A G 3: 28,895,615 D8G probably damaging Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Itga8 G A 2: 12,178,680 T751I possibly damaging Het
Kif5a A G 10: 127,231,336 V904A probably benign Het
Lpgat1 A G 1: 191,760,209 E269G probably benign Het
Olfr536 T A 7: 140,503,552 K302N probably benign Het
Pde4d A G 13: 109,927,197 probably benign Het
Rita1 T C 5: 120,609,939 Y98C probably damaging Het
Surf1 A G 2: 26,913,907 probably null Het
Sv2c A G 13: 96,048,576 Y198H probably damaging Het
Svs3a T C 2: 164,289,631 F41L possibly damaging Het
Tigd2 A G 6: 59,209,995 probably benign Het
Tubb4a C A 17: 57,086,285 G38W probably damaging Het
Tyrp1 G A 4: 80,846,606 V7I probably benign Het
Unc45a A G 7: 80,329,057 Y615H probably damaging Het
Wisp1 T A 15: 66,912,857 D126E possibly damaging Het
Other mutations in 4933412E24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:4933412E24Rik APN 15 60015575 missense possibly damaging 0.82
IGL02078:4933412E24Rik APN 15 60016330 missense probably benign 0.02
IGL02493:4933412E24Rik APN 15 60016463 missense probably benign 0.00
IGL03336:4933412E24Rik APN 15 60016402 missense probably benign 0.00
R0466:4933412E24Rik UTSW 15 60015472 missense probably benign 0.00
R0961:4933412E24Rik UTSW 15 60015311 missense probably benign 0.36
R1765:4933412E24Rik UTSW 15 60015345 nonsense probably null
R2341:4933412E24Rik UTSW 15 60016363 missense possibly damaging 0.85
R3162:4933412E24Rik UTSW 15 60016285 missense probably damaging 1.00
R3162:4933412E24Rik UTSW 15 60016285 missense probably damaging 1.00
R4039:4933412E24Rik UTSW 15 60016366 missense possibly damaging 0.95
R4416:4933412E24Rik UTSW 15 60016423 missense possibly damaging 0.88
R4868:4933412E24Rik UTSW 15 60015968 missense possibly damaging 0.50
R4907:4933412E24Rik UTSW 15 60016108 missense probably benign 0.00
R5462:4933412E24Rik UTSW 15 60015068 missense probably benign 0.09
R7275:4933412E24Rik UTSW 15 60015889 missense probably benign 0.32
R7842:4933412E24Rik UTSW 15 60016573 missense probably damaging 1.00
R7925:4933412E24Rik UTSW 15 60016573 missense probably damaging 1.00
X0052:4933412E24Rik UTSW 15 60016526 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCCGATCACCATTCTACTAGTGG -3'
(R):5'- AGCAAGCTCACGTTGGTGTC -3'

Sequencing Primer
(F):5'- GGTGACCCAAGATCTGCTTTGC -3'
(R):5'- TCACGTTGGTGTCCCAGCTG -3'
Posted On2014-11-12