Incidental Mutation 'R2440:Wisp1'
ID249767
Institutional Source Beutler Lab
Gene Symbol Wisp1
Ensembl Gene ENSMUSG00000005124
Gene NameWNT1 inducible signaling pathway protein 1
SynonymsCCN4, Elm1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R2440 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location66891320-66923201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66912857 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 126 (D126E)
Ref Sequence ENSEMBL: ENSMUSP00000005255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005255] [ENSMUST00000118823] [ENSMUST00000147079]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005255
AA Change: D126E

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000005255
Gene: ENSMUSG00000005124
AA Change: D126E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IB 49 117 6.39e-13 SMART
VWC 123 185 5.63e-13 SMART
TSP1 217 260 4.34e-5 SMART
CT 278 347 1.42e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118823
SMART Domains Protein: ENSMUSP00000113144
Gene: ENSMUSG00000005124

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IB 49 117 3.19e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133863
Predicted Effect probably benign
Transcript: ENSMUST00000147079
SMART Domains Protein: ENSMUSP00000117402
Gene: ENSMUSG00000005124

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230535
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. It is expressed at a high level in fibroblast cells, and overexpressed in colon tumors. The encoded protein binds to decorin and biglycan, two members of a family of small leucine-rich proteoglycans present in the extracellular matrix of connective tissue, and possibly prevents the inhibitory activity of decorin and biglycan in tumor cell proliferation. It also attenuates p53-mediated apoptosis in response to DNA damage through activation of the Akt kinase. It is 83% identical to the mouse protein at the amino acid level. Multiple alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit impaired motor coordination during inverted screen testing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik T C 15: 60,016,280 T104A probably benign Het
5830473C10Rik A G 5: 90,572,689 probably null Het
Adar A G 3: 89,734,854 H14R possibly damaging Het
Alcam T A 16: 52,305,613 M114L probably damaging Het
Cntn5 A G 9: 10,171,955 Y75H possibly damaging Het
Coch T C 12: 51,596,562 S122P probably damaging Het
Cyp2c69 T C 19: 39,876,294 K247E probably benign Het
Gm1527 A G 3: 28,895,615 D8G probably damaging Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Itga8 G A 2: 12,178,680 T751I possibly damaging Het
Kif5a A G 10: 127,231,336 V904A probably benign Het
Lpgat1 A G 1: 191,760,209 E269G probably benign Het
Olfr536 T A 7: 140,503,552 K302N probably benign Het
Pde4d A G 13: 109,927,197 probably benign Het
Rita1 T C 5: 120,609,939 Y98C probably damaging Het
Surf1 A G 2: 26,913,907 probably null Het
Sv2c A G 13: 96,048,576 Y198H probably damaging Het
Svs3a T C 2: 164,289,631 F41L possibly damaging Het
Tigd2 A G 6: 59,209,995 probably benign Het
Tubb4a C A 17: 57,086,285 G38W probably damaging Het
Tyrp1 G A 4: 80,846,606 V7I probably benign Het
Unc45a A G 7: 80,329,057 Y615H probably damaging Het
Other mutations in Wisp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03051:Wisp1 APN 15 66906550 nonsense probably null
IGL03057:Wisp1 APN 15 66891640 splice site probably benign
R0029:Wisp1 UTSW 15 66912864 missense probably damaging 1.00
R0125:Wisp1 UTSW 15 66917345 missense possibly damaging 0.82
R0164:Wisp1 UTSW 15 66919210 missense probably damaging 1.00
R0164:Wisp1 UTSW 15 66919210 missense probably damaging 1.00
R0470:Wisp1 UTSW 15 66917378 missense probably benign 0.13
R0847:Wisp1 UTSW 15 66919275 missense probably damaging 1.00
R1463:Wisp1 UTSW 15 66919271 missense possibly damaging 0.52
R1623:Wisp1 UTSW 15 66891599 missense possibly damaging 0.46
R1785:Wisp1 UTSW 15 66906489 missense probably damaging 1.00
R1786:Wisp1 UTSW 15 66906489 missense probably damaging 1.00
R2027:Wisp1 UTSW 15 66917409 missense possibly damaging 0.50
R2104:Wisp1 UTSW 15 66919327 missense probably benign 0.11
R3791:Wisp1 UTSW 15 66919288 missense probably damaging 1.00
R4748:Wisp1 UTSW 15 66906640 nonsense probably null
R5317:Wisp1 UTSW 15 66917282 missense probably benign
R6960:Wisp1 UTSW 15 66919198 missense probably benign 0.00
R7144:Wisp1 UTSW 15 66913030 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTGCAGCCAGATGATATGTG -3'
(R):5'- GTGTCCAACAGTGCAGTCTG -3'

Sequencing Primer
(F):5'- ATGATATGTGGACCAGGCCCTC -3'
(R):5'- AACAGTGCAGTCTGGCGTG -3'
Posted On2014-11-12