Incidental Mutation 'R0308:Senp6'
ID24978
Institutional Source Beutler Lab
Gene Symbol Senp6
Ensembl Gene ENSMUSG00000034252
Gene NameSUMO/sentrin specific peptidase 6
SynonymsE130319N12Rik, 2810017C20Rik
MMRRC Submission 038518-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0308 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location80066903-80144953 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 80132983 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037484] [ENSMUST00000164859] [ENSMUST00000165607] [ENSMUST00000175999] [ENSMUST00000176527]
Predicted Effect probably null
Transcript: ENSMUST00000037484
SMART Domains Protein: ENSMUSP00000047220
Gene: ENSMUSG00000034252

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
ZnF_C2HC 242 260 7.23e0 SMART
Pfam:Peptidase_C48 700 826 3.5e-23 PFAM
Pfam:Peptidase_C48 965 1096 1.1e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164859
SMART Domains Protein: ENSMUSP00000128918
Gene: ENSMUSG00000034252

DomainStartEndE-ValueType
ZnF_C2HC 76 94 7.23e0 SMART
Pfam:Peptidase_C48 534 660 5.2e-23 PFAM
Pfam:Peptidase_C48 799 930 1.6e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000165607
SMART Domains Protein: ENSMUSP00000126777
Gene: ENSMUSG00000034252

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
ZnF_C2HC 249 267 7.23e0 SMART
Pfam:Peptidase_C48 707 833 3.4e-23 PFAM
Pfam:Peptidase_C48 972 1103 1.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175758
Predicted Effect probably benign
Transcript: ENSMUST00000175999
Predicted Effect probably benign
Transcript: ENSMUST00000176527
SMART Domains Protein: ENSMUSP00000135719
Gene: ENSMUSG00000034252

DomainStartEndE-ValueType
Pfam:Peptidase_C48 114 165 6.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176607
SMART Domains Protein: ENSMUSP00000135231
Gene: ENSMUSG00000034252

DomainStartEndE-ValueType
ZnF_C2HC 76 94 7.23e0 SMART
Pfam:Peptidase_C48 534 660 4.9e-23 PFAM
Pfam:Peptidase_C48 799 911 2.1e-14 PFAM
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin-like molecules (UBLs), such as SUMO1 (UBL1; MIM 601912), are structurally related to ubiquitin (MIM 191339) and can be ligated to target proteins in a similar manner as ubiquitin. However, covalent attachment of UBLs does not result in degradation of the modified proteins. SUMO1 modification is implicated in the targeting of RANGAP1 (MIM 602362) to the nuclear pore complex, as well as in stabilization of I-kappa-B-alpha (NFKBIA; MIM 164008) from degradation by the 26S proteasome. Like ubiquitin, UBLs are synthesized as precursor proteins, with 1 or more amino acids following the C-terminal glycine-glycine residues of the mature UBL protein. Thus, the tail sequences of the UBL precursors need to be removed by UBL-specific proteases, such as SENP6, prior to their conjugation to target proteins (Kim et al., 2000 [PubMed 10799485]). SENPs also display isopeptidase activity for deconjugation of SUMO-conjugated substrates (Lima and Reverter, 2008 [PubMed 18799455]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,989 D65V probably damaging Het
4933407L21Rik A T 1: 85,931,286 probably benign Het
Abcc12 C T 8: 86,557,752 probably benign Het
Adamts12 A G 15: 11,311,560 E1301G probably damaging Het
Adh4 A T 3: 138,424,102 N230Y probably damaging Het
Anapc15-ps T A 10: 95,673,092 M109L probably benign Het
Angpt2 T C 8: 18,692,125 I472V possibly damaging Het
Arhgef26 C A 3: 62,340,399 D301E probably benign Het
Armc10 G A 5: 21,647,297 probably benign Het
Arntl A T 7: 113,291,536 I179F probably damaging Het
Atm T C 9: 53,454,473 probably null Het
Atp5b T C 10: 128,086,039 V265A probably benign Het
Atp8b1 G T 18: 64,545,244 C860* probably null Het
Atrnl1 T G 19: 57,753,288 S1160A probably benign Het
Cep55 A G 19: 38,060,211 E105G possibly damaging Het
Cfap54 C A 10: 92,885,364 D2502Y unknown Het
Cilp2 A G 8: 69,882,993 S452P probably benign Het
Clptm1l A G 13: 73,611,667 D282G possibly damaging Het
Csrp1 C A 1: 135,745,286 T47N probably damaging Het
Cyp2c40 T A 19: 39,777,988 I388F probably damaging Het
Dars C T 1: 128,364,259 R494H probably damaging Het
Dna2 T C 10: 62,956,974 V256A probably damaging Het
Dock7 T C 4: 98,984,814 T1132A probably benign Het
Elk3 A T 10: 93,265,205 M228K probably benign Het
Erich6 A G 3: 58,636,104 F182L probably damaging Het
Fhad1 A G 4: 141,985,593 probably benign Het
Fryl A T 5: 73,041,604 probably benign Het
Fzd9 A T 5: 135,249,406 C542S probably damaging Het
Gba A G 3: 89,208,364 T460A probably benign Het
Gli2 C T 1: 118,842,062 A587T probably benign Het
Gm10037 A G 13: 67,843,113 probably benign Het
Gm11011 C T 2: 169,582,694 probably benign Het
Gm17018 T G 19: 45,577,006 F140V probably damaging Het
Gm9745 T G 13: 8,940,841 probably benign Het
Gmppb A G 9: 108,049,834 E68G probably benign Het
Gpld1 A G 13: 24,962,835 N260S possibly damaging Het
Hipk3 G A 2: 104,433,207 S900L probably damaging Het
Ints6l A T X: 56,481,355 M215L possibly damaging Het
Irx6 T A 8: 92,677,031 L128Q probably damaging Het
Itga10 T C 3: 96,651,464 S373P probably damaging Het
Jak1 T C 4: 101,154,535 probably null Het
Jak2 C T 19: 29,311,757 T1103I probably benign Het
Katnal1 A T 5: 148,878,924 V401D possibly damaging Het
Lrp2 T A 2: 69,482,982 probably benign Het
Map3k13 A G 16: 21,891,988 H7R probably benign Het
Mrgprx3-ps A G 7: 47,310,018 V75A probably benign Het
Nol6 C T 4: 41,123,584 A55T probably benign Het
Olfr881 A G 9: 37,992,845 I118V probably benign Het
Opa1 G A 16: 29,621,531 R818Q probably damaging Het
Opn4 T C 14: 34,597,124 Y168C possibly damaging Het
Phf21a T C 2: 92,330,777 V330A possibly damaging Het
Phykpl A G 11: 51,593,596 probably benign Het
Plcb1 T G 2: 134,813,614 V38G probably benign Het
Plxna4 T A 6: 32,237,768 T593S probably benign Het
Poll A T 19: 45,555,965 I339N probably damaging Het
Rev3l A G 10: 39,824,894 I1796V probably benign Het
Rnf103 G A 6: 71,509,702 R439H probably damaging Het
Rrn3 G A 16: 13,799,882 probably benign Het
Sec14l4 G A 11: 4,041,726 probably benign Het
Sec23a A C 12: 59,007,199 Y4* probably null Het
Serpinb6b A T 13: 32,978,237 N221Y probably benign Het
Slc6a2 A G 8: 92,961,360 E38G possibly damaging Het
Smap1 A T 1: 23,849,342 L196I probably damaging Het
Sorbs2 C T 8: 45,795,130 Q473* probably null Het
Sphkap C A 1: 83,276,969 V1020F probably damaging Het
Srfbp1 T C 18: 52,488,542 V225A probably benign Het
Srprb G A 9: 103,202,005 P728S possibly damaging Het
Tarm1 T C 7: 3,496,671 probably benign Het
Tcp1 T A 17: 12,920,419 I162N probably benign Het
Tmem237 C A 1: 59,107,517 A292S probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnpo1 A G 13: 98,846,503 F884L probably damaging Het
Trim7 A G 11: 48,849,501 T142A probably damaging Het
Ttn T A 2: 76,785,680 I14894F probably damaging Het
Tubgcp6 T C 15: 89,122,436 R128G possibly damaging Het
Ube2d2b A G 5: 107,830,908 T142A possibly damaging Het
Unc13c G T 9: 73,481,118 L2129I probably benign Het
Ushbp1 T C 8: 71,391,053 D247G probably damaging Het
Usp43 G A 11: 67,880,140 A556V probably damaging Het
Zfp438 T A 18: 5,213,638 H440L probably benign Het
Zfp518b C T 5: 38,672,770 E631K possibly damaging Het
Other mutations in Senp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Senp6 APN 9 80116610 missense probably damaging 1.00
IGL00487:Senp6 APN 9 80113838 missense probably damaging 1.00
IGL01285:Senp6 APN 9 80136718 missense probably benign 0.05
IGL01337:Senp6 APN 9 80136510 missense probably damaging 0.97
IGL01563:Senp6 APN 9 80122008 missense probably benign
IGL01633:Senp6 APN 9 80092394 missense probably damaging 1.00
IGL02115:Senp6 APN 9 80121926 missense probably damaging 1.00
IGL02208:Senp6 APN 9 80113943 missense probably damaging 1.00
IGL02378:Senp6 APN 9 80126392 missense probably damaging 1.00
A4554:Senp6 UTSW 9 80148458 unclassified probably benign
R0031:Senp6 UTSW 9 80126243 missense probably damaging 1.00
R0121:Senp6 UTSW 9 80116670 missense probably benign 0.01
R0276:Senp6 UTSW 9 80136747 missense probably benign
R0294:Senp6 UTSW 9 80113725 splice site probably null
R0531:Senp6 UTSW 9 80123884 missense probably damaging 0.99
R0743:Senp6 UTSW 9 80093589 missense probably damaging 1.00
R0883:Senp6 UTSW 9 80116559 missense probably damaging 1.00
R1071:Senp6 UTSW 9 80136729 missense probably benign 0.35
R1171:Senp6 UTSW 9 80116725 missense possibly damaging 0.89
R1340:Senp6 UTSW 9 80122023 missense possibly damaging 0.47
R1571:Senp6 UTSW 9 80093571 missense probably damaging 1.00
R1760:Senp6 UTSW 9 80118629 missense probably benign 0.36
R1909:Senp6 UTSW 9 80113774 missense possibly damaging 0.67
R2008:Senp6 UTSW 9 80126398 missense probably damaging 1.00
R2067:Senp6 UTSW 9 80089869 missense probably benign 0.11
R2077:Senp6 UTSW 9 80126155 missense probably benign 0.14
R2141:Senp6 UTSW 9 80123820 missense probably damaging 1.00
R2321:Senp6 UTSW 9 80123740 missense possibly damaging 0.83
R2760:Senp6 UTSW 9 80121978 missense probably null
R2939:Senp6 UTSW 9 80143842 missense probably benign 0.00
R2940:Senp6 UTSW 9 80143842 missense probably benign 0.00
R3081:Senp6 UTSW 9 80143842 missense probably benign 0.00
R3784:Senp6 UTSW 9 80092286 missense probably benign 0.16
R3785:Senp6 UTSW 9 80092286 missense probably benign 0.16
R3800:Senp6 UTSW 9 80087453 missense possibly damaging 0.89
R3857:Senp6 UTSW 9 80092321 missense possibly damaging 0.85
R4790:Senp6 UTSW 9 80089858 missense probably benign 0.20
R5117:Senp6 UTSW 9 80130746 missense probably damaging 1.00
R5418:Senp6 UTSW 9 80121869 missense possibly damaging 0.89
R5477:Senp6 UTSW 9 80143843 missense probably damaging 1.00
R5582:Senp6 UTSW 9 80089876 missense possibly damaging 0.91
R5717:Senp6 UTSW 9 80092312 missense probably damaging 0.99
R5800:Senp6 UTSW 9 80126433 missense probably damaging 1.00
R5802:Senp6 UTSW 9 80118644 unclassified probably benign
R5899:Senp6 UTSW 9 80142070 splice site probably benign
R5918:Senp6 UTSW 9 80114116 critical splice donor site probably null
R5958:Senp6 UTSW 9 80142294 missense probably damaging 1.00
R6360:Senp6 UTSW 9 80113806 missense probably benign
R6477:Senp6 UTSW 9 80093625 nonsense probably null
R6628:Senp6 UTSW 9 80132954 missense probably damaging 1.00
R6703:Senp6 UTSW 9 80121921 missense probably damaging 1.00
R7236:Senp6 UTSW 9 80132965 missense probably damaging 1.00
R7268:Senp6 UTSW 9 80142124 missense probably damaging 1.00
R7290:Senp6 UTSW 9 80136515 missense probably benign 0.25
R7319:Senp6 UTSW 9 80126199 missense probably damaging 1.00
R7422:Senp6 UTSW 9 80113877 missense probably damaging 1.00
R7474:Senp6 UTSW 9 80142328 missense probably damaging 1.00
R7480:Senp6 UTSW 9 80121917 missense probably damaging 1.00
R7491:Senp6 UTSW 9 80123728 nonsense probably null
R8428:Senp6 UTSW 9 80118512 missense probably damaging 1.00
R8920:Senp6 UTSW 9 80092279 missense not run
Z1176:Senp6 UTSW 9 80142266 missense probably benign 0.02
Z1177:Senp6 UTSW 9 80103693 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGGTGAAACTGTGTGAGGTGTTACAGC -3'
(R):5'- TACGTCAACACTGGCAGAGTCACTGG -3'

Sequencing Primer
(F):5'- AGCTGACTCCTCTAATTATAAGTCAC -3'
(R):5'- GACTGCTTCCAATAGCATGGC -3'
Posted On2013-04-16