Incidental Mutation 'R2441:Olfr470'
ID249787
Institutional Source Beutler Lab
Gene Symbol Olfr470
Ensembl Gene ENSMUSG00000109542
Gene Nameolfactory receptor 470
SynonymsMOR204-22, GA_x6K02T2PBJ9-10175273-10174329
MMRRC Submission 040399-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R2441 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location107842905-107847490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107844978 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 252 (T252A)
Ref Sequence ENSEMBL: ENSMUSP00000151543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073059] [ENSMUST00000220193]
Predicted Effect probably benign
Transcript: ENSMUST00000073059
AA Change: T252A

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000072810
Gene: ENSMUSG00000109542
AA Change: T252A

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2e-56 PFAM
Pfam:7tm_1 44 293 2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084757
AA Change: T252A

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000081812
Gene: ENSMUSG00000094289
AA Change: T252A

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.5e-51 PFAM
Pfam:7tm_1 44 293 1.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219309
Predicted Effect probably benign
Transcript: ENSMUST00000220193
AA Change: T252A

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,492 N172S possibly damaging Het
AY358078 A G 14: 51,800,089 H15R probably benign Het
Boc A G 16: 44,488,623 V842A probably damaging Het
Chuk T A 19: 44,096,921 N262I probably damaging Het
Erich6 A T 3: 58,618,811 L590Q probably damaging Het
Fsip2 A T 2: 82,985,341 H3806L possibly damaging Het
Gucy1b1 T C 3: 82,045,454 D224G probably damaging Het
Hgf A T 5: 16,604,790 H426L probably damaging Het
Nrxn2 G T 19: 6,428,301 G85W probably damaging Het
Ntrk3 A T 7: 78,302,662 N602K probably damaging Het
Olfr62 G A 4: 118,666,135 G206D possibly damaging Het
P3h4 G A 11: 100,413,768 R216W probably damaging Het
Pced1b T A 15: 97,384,285 D68E possibly damaging Het
Pzp A T 6: 128,489,768 L1161* probably null Het
Rprd1a A T 18: 24,507,200 L173* probably null Het
Slfn3 A G 11: 83,212,683 I127V probably benign Het
Sp100 A G 1: 85,703,489 probably benign Het
Tbx15 T G 3: 99,352,511 M566R probably damaging Het
Tesmin G A 19: 3,402,577 probably null Het
Tmem132a A G 19: 10,860,137 V603A probably damaging Het
Tob2 G T 15: 81,851,722 Y15* probably null Het
Trim23 A T 13: 104,192,075 Q307L probably damaging Het
Trpc4 A T 3: 54,222,283 I157L probably damaging Het
Tsen34 A T 7: 3,694,995 K87N possibly damaging Het
Ubr5 A G 15: 37,989,345 S2076P probably damaging Het
Vmn2r59 C T 7: 42,046,146 V281I probably benign Het
Vwa3b T C 1: 37,143,069 probably benign Het
Zfp384 C T 6: 125,036,649 P544L probably benign Het
Other mutations in Olfr470
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02034:Olfr470 APN 7 107845178 missense probably benign 0.00
IGL02349:Olfr470 APN 7 107845605 missense probably benign 0.03
IGL02365:Olfr470 APN 7 107844912 missense probably damaging 1.00
R0070:Olfr470 UTSW 7 107844917 missense probably damaging 0.99
R0540:Olfr470 UTSW 7 107845569 missense probably damaging 0.98
R0607:Olfr470 UTSW 7 107845569 missense probably damaging 0.98
R0624:Olfr470 UTSW 7 107845116 missense possibly damaging 0.87
R1983:Olfr470 UTSW 7 107845412 missense probably benign 0.36
R2420:Olfr470 UTSW 7 107844818 missense probably benign 0.03
R4395:Olfr470 UTSW 7 107845262 missense probably damaging 1.00
R4734:Olfr470 UTSW 7 107845428 missense probably benign 0.00
R4779:Olfr470 UTSW 7 107845548 missense possibly damaging 0.96
R5874:Olfr470 UTSW 7 107845170 missense probably benign
R6598:Olfr470 UTSW 7 107845263 missense probably benign 0.06
R6807:Olfr470 UTSW 7 107845590 missense possibly damaging 0.67
R6820:Olfr470 UTSW 7 107845091 missense probably benign 0.01
R7305:Olfr470 UTSW 7 107845365 missense probably damaging 1.00
R7413:Olfr470 UTSW 7 107845514 missense probably damaging 1.00
R7954:Olfr470 UTSW 7 107844912 missense probably benign 0.01
R8215:Olfr470 UTSW 7 107844917 missense probably damaging 0.99
R8255:Olfr470 UTSW 7 107845161 missense probably damaging 1.00
R8384:Olfr470 UTSW 7 107845258 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGCTGTCTCTTCAGAGCACC -3'
(R):5'- TCTGTGGACCAAATAGAGTCAATCAC -3'

Sequencing Primer
(F):5'- TCAGAGCACCCTTAATCTCATTG -3'
(R):5'- ATAGAGCTCTCCTGTTCAGGTAGC -3'
Posted On2014-11-12