Mutagenetix > Incidental Mutations

Incidental Mutation 'R2441:AY358078'

249795

Institutional Source

Beutler Lab

Gene Symbol

AY358078

Ensembl Gene

ENSMUSG00000050961

Gene Name

cDNA sequence AY358078

Synonyms

MMRRC Submission

040399-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R2441 (G1)

Quality Score

152

Status

Not validated

Chromosome

Chromosomal Location

51800046-51826359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 51800089 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 15 (H15R)

Ref Sequence

ENSEMBL: ENSMUSP00000078129 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053821]

Predicted Effect

probably benign
Transcript: ENSMUST00000053821
AA Change: H15R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000078129
Gene: ENSMUSG00000050961
AA Change: H15R

Domain	Start	End	E-Value	Type
Pfam:Takusan	91	171	5.5e-26	PFAM
coiled coil region	187	220	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	C	14: 32,663,492	N172S	possibly damaging	Het
Boc	A	G	16: 44,488,623	V842A	probably damaging	Het
Chuk	T	A	19: 44,096,921	N262I	probably damaging	Het
Erich6	A	T	3: 58,618,811	L590Q	probably damaging	Het
Fsip2	A	T	2: 82,985,341	H3806L	possibly damaging	Het
Gucy1b1	T	C	3: 82,045,454	D224G	probably damaging	Het
Hgf	A	T	5: 16,604,790	H426L	probably damaging	Het
Nrxn2	G	T	19: 6,428,301	G85W	probably damaging	Het
Ntrk3	A	T	7: 78,302,662	N602K	probably damaging	Het
Olfr470	T	C	7: 107,844,978	T252A	probably benign	Het
Olfr62	G	A	4: 118,666,135	G206D	possibly damaging	Het
P3h4	G	A	11: 100,413,768	R216W	probably damaging	Het
Pced1b	T	A	15: 97,384,285	D68E	possibly damaging	Het
Pzp	A	T	6: 128,489,768	L1161*	probably null	Het
Rprd1a	A	T	18: 24,507,200	L173*	probably null	Het
Slfn3	A	G	11: 83,212,683	I127V	probably benign	Het
Sp100	A	G	1: 85,703,489		probably benign	Het
Tbx15	T	G	3: 99,352,511	M566R	probably damaging	Het
Tesmin	G	A	19: 3,402,577		probably null	Het
Tmem132a	A	G	19: 10,860,137	V603A	probably damaging	Het
Tob2	G	T	15: 81,851,722	Y15*	probably null	Het
Trim23	A	T	13: 104,192,075	Q307L	probably damaging	Het
Trpc4	A	T	3: 54,222,283	I157L	probably damaging	Het
Tsen34	A	T	7: 3,694,995	K87N	possibly damaging	Het
Ubr5	A	G	15: 37,989,345	S2076P	probably damaging	Het
Vmn2r59	C	T	7: 42,046,146	V281I	probably benign	Het
Vwa3b	T	C	1: 37,143,069		probably benign	Het
Zfp384	C	T	6: 125,036,649	P544L	probably benign	Het

Other mutations in AY358078

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:AY358078	APN	14	51805709	splice site	probably benign
IGL02053:AY358078	APN	14	51805552	missense	unknown
IGL02057:AY358078	APN	14	51820305	missense	unknown
IGL02498:AY358078	APN	14	51803487	missense	probably benign	0.00
FR4737:AY358078	UTSW	14	51805698	missense	unknown
R0140:AY358078	UTSW	14	51825942	missense	probably benign	0.12
R0466:AY358078	UTSW	14	51805632	missense	unknown
R0496:AY358078	UTSW	14	51803532	missense	unknown
R1546:AY358078	UTSW	14	51820419	intron	probably null
R1793:AY358078	UTSW	14	51804594	missense	unknown
R1867:AY358078	UTSW	14	51800047	start codon destroyed	probably null	0.01
R1993:AY358078	UTSW	14	51826062	missense	probably damaging	1.00
R1994:AY358078	UTSW	14	51826062	missense	probably damaging	1.00
R1995:AY358078	UTSW	14	51826062	missense	probably damaging	1.00
R2184:AY358078	UTSW	14	51825988	missense	probably damaging	1.00
R2322:AY358078	UTSW	14	51804690	missense	unknown
R3851:AY358078	UTSW	14	51805553	missense	unknown
R3852:AY358078	UTSW	14	51805553	missense	unknown
R4600:AY358078	UTSW	14	51826075	missense	possibly damaging	0.89
R4603:AY358078	UTSW	14	51826075	missense	possibly damaging	0.89
R4610:AY358078	UTSW	14	51826075	missense	possibly damaging	0.89
R4611:AY358078	UTSW	14	51826075	missense	possibly damaging	0.89
R4916:AY358078	UTSW	14	51802651	missense	unknown
R5096:AY358078	UTSW	14	51826118	missense	probably benign	0.19
R5143:AY358078	UTSW	14	51802549	missense	unknown
R5609:AY358078	UTSW	14	51804608	missense	unknown
R5651:AY358078	UTSW	14	51822160	missense	unknown
R6345:AY358078	UTSW	14	51826292	missense	probably damaging	1.00
R6988:AY358078	UTSW	14	51826187	missense	probably damaging	0.99
R7340:AY358078	UTSW	14	51826259	missense	probably damaging	1.00
RF002:AY358078	UTSW	14	51805593	nonsense	probably null
RF017:AY358078	UTSW	14	51805593	nonsense	probably null
RF025:AY358078	UTSW	14	51805589	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGGCTTAGGACACTAGTGGG -3'
(R):5'- AGTCACCCTACTTTACAACATCTAG -3'

Sequencing Primer
(F):5'- GCTTAGGACACTAGTGGGAGTAG -3'
(R):5'- GTTAGTAGAACAATATAGTTTGCCCC -3'

Posted On

2014-11-12