Incidental Mutation 'R2441:AY358078'
ID249795
Institutional Source Beutler Lab
Gene Symbol AY358078
Ensembl Gene ENSMUSG00000050961
Gene NamecDNA sequence AY358078
Synonyms
MMRRC Submission 040399-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R2441 (G1)
Quality Score152
Status Not validated
Chromosome14
Chromosomal Location51800046-51826359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51800089 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 15 (H15R)
Ref Sequence ENSEMBL: ENSMUSP00000078129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053821]
Predicted Effect probably benign
Transcript: ENSMUST00000053821
AA Change: H15R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000078129
Gene: ENSMUSG00000050961
AA Change: H15R

DomainStartEndE-ValueType
Pfam:Takusan 91 171 5.5e-26 PFAM
coiled coil region 187 220 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,492 N172S possibly damaging Het
Boc A G 16: 44,488,623 V842A probably damaging Het
Chuk T A 19: 44,096,921 N262I probably damaging Het
Erich6 A T 3: 58,618,811 L590Q probably damaging Het
Fsip2 A T 2: 82,985,341 H3806L possibly damaging Het
Gucy1b1 T C 3: 82,045,454 D224G probably damaging Het
Hgf A T 5: 16,604,790 H426L probably damaging Het
Nrxn2 G T 19: 6,428,301 G85W probably damaging Het
Ntrk3 A T 7: 78,302,662 N602K probably damaging Het
Olfr470 T C 7: 107,844,978 T252A probably benign Het
Olfr62 G A 4: 118,666,135 G206D possibly damaging Het
P3h4 G A 11: 100,413,768 R216W probably damaging Het
Pced1b T A 15: 97,384,285 D68E possibly damaging Het
Pzp A T 6: 128,489,768 L1161* probably null Het
Rprd1a A T 18: 24,507,200 L173* probably null Het
Slfn3 A G 11: 83,212,683 I127V probably benign Het
Sp100 A G 1: 85,703,489 probably benign Het
Tbx15 T G 3: 99,352,511 M566R probably damaging Het
Tesmin G A 19: 3,402,577 probably null Het
Tmem132a A G 19: 10,860,137 V603A probably damaging Het
Tob2 G T 15: 81,851,722 Y15* probably null Het
Trim23 A T 13: 104,192,075 Q307L probably damaging Het
Trpc4 A T 3: 54,222,283 I157L probably damaging Het
Tsen34 A T 7: 3,694,995 K87N possibly damaging Het
Ubr5 A G 15: 37,989,345 S2076P probably damaging Het
Vmn2r59 C T 7: 42,046,146 V281I probably benign Het
Vwa3b T C 1: 37,143,069 probably benign Het
Zfp384 C T 6: 125,036,649 P544L probably benign Het
Other mutations in AY358078
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:AY358078 APN 14 51805709 splice site probably benign
IGL02053:AY358078 APN 14 51805552 missense unknown
IGL02057:AY358078 APN 14 51820305 missense unknown
IGL02498:AY358078 APN 14 51803487 missense probably benign 0.00
FR4737:AY358078 UTSW 14 51805698 missense unknown
R0140:AY358078 UTSW 14 51825942 missense probably benign 0.12
R0466:AY358078 UTSW 14 51805632 missense unknown
R0496:AY358078 UTSW 14 51803532 missense unknown
R1546:AY358078 UTSW 14 51820419 intron probably null
R1793:AY358078 UTSW 14 51804594 missense unknown
R1867:AY358078 UTSW 14 51800047 start codon destroyed probably null 0.01
R1993:AY358078 UTSW 14 51826062 missense probably damaging 1.00
R1994:AY358078 UTSW 14 51826062 missense probably damaging 1.00
R1995:AY358078 UTSW 14 51826062 missense probably damaging 1.00
R2184:AY358078 UTSW 14 51825988 missense probably damaging 1.00
R2322:AY358078 UTSW 14 51804690 missense unknown
R3851:AY358078 UTSW 14 51805553 missense unknown
R3852:AY358078 UTSW 14 51805553 missense unknown
R4600:AY358078 UTSW 14 51826075 missense possibly damaging 0.89
R4603:AY358078 UTSW 14 51826075 missense possibly damaging 0.89
R4610:AY358078 UTSW 14 51826075 missense possibly damaging 0.89
R4611:AY358078 UTSW 14 51826075 missense possibly damaging 0.89
R4916:AY358078 UTSW 14 51802651 missense unknown
R5096:AY358078 UTSW 14 51826118 missense probably benign 0.19
R5143:AY358078 UTSW 14 51802549 missense unknown
R5609:AY358078 UTSW 14 51804608 missense unknown
R5651:AY358078 UTSW 14 51822160 missense unknown
R6345:AY358078 UTSW 14 51826292 missense probably damaging 1.00
R6988:AY358078 UTSW 14 51826187 missense probably damaging 0.99
R7340:AY358078 UTSW 14 51826259 missense probably damaging 1.00
RF002:AY358078 UTSW 14 51805593 nonsense probably null
RF017:AY358078 UTSW 14 51805593 nonsense probably null
RF025:AY358078 UTSW 14 51805589 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGCTTAGGACACTAGTGGG -3'
(R):5'- AGTCACCCTACTTTACAACATCTAG -3'

Sequencing Primer
(F):5'- GCTTAGGACACTAGTGGGAGTAG -3'
(R):5'- GTTAGTAGAACAATATAGTTTGCCCC -3'
Posted On2014-11-12