Incidental Mutation 'R2441:Tesmin'
ID249801
Institutional Source Beutler Lab
Gene Symbol Tesmin
Ensembl Gene ENSMUSG00000024905
Gene Nametestis expressed metallothionein like
SynonymsMtl5, tesmin
MMRRC Submission 040399-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R2441 (G1)
Quality Score121
Status Not validated
Chromosome19
Chromosomal Location3388857-3407823 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 3402577 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025840] [ENSMUST00000127142] [ENSMUST00000142193] [ENSMUST00000151341]
Predicted Effect probably null
Transcript: ENSMUST00000025840
SMART Domains Protein: ENSMUSP00000025840
Gene: ENSMUSG00000024905

DomainStartEndE-ValueType
low complexity region 91 99 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
Blast:CXC 246 287 4e-13 BLAST
CXC 332 373 1.37e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127142
SMART Domains Protein: ENSMUSP00000122687
Gene: ENSMUSG00000024905

DomainStartEndE-ValueType
Blast:CXC 67 107 1e-13 BLAST
CXC 152 193 1.37e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000142193
SMART Domains Protein: ENSMUSP00000114171
Gene: ENSMUSG00000024905

DomainStartEndE-ValueType
Blast:CXC 67 107 1e-13 BLAST
CXC 152 193 1.37e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151341
SMART Domains Protein: ENSMUSP00000114142
Gene: ENSMUSG00000024905

DomainStartEndE-ValueType
low complexity region 91 99 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metallothionein proteins are highly conserved low-molecular-weight cysteine-rich proteins that are induced by and bind to heavy metal ions and have no enzymatic activity. They may play a central role in the regulation of cell growth and differentiation and are involved in spermatogenesis. This gene encodes a metallothionein-like protein which has been shown to be expressed differentially in mouse testis and ovary. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,492 N172S possibly damaging Het
AY358078 A G 14: 51,800,089 H15R probably benign Het
Boc A G 16: 44,488,623 V842A probably damaging Het
Chuk T A 19: 44,096,921 N262I probably damaging Het
Erich6 A T 3: 58,618,811 L590Q probably damaging Het
Fsip2 A T 2: 82,985,341 H3806L possibly damaging Het
Gucy1b1 T C 3: 82,045,454 D224G probably damaging Het
Hgf A T 5: 16,604,790 H426L probably damaging Het
Nrxn2 G T 19: 6,428,301 G85W probably damaging Het
Ntrk3 A T 7: 78,302,662 N602K probably damaging Het
Olfr470 T C 7: 107,844,978 T252A probably benign Het
Olfr62 G A 4: 118,666,135 G206D possibly damaging Het
P3h4 G A 11: 100,413,768 R216W probably damaging Het
Pced1b T A 15: 97,384,285 D68E possibly damaging Het
Pzp A T 6: 128,489,768 L1161* probably null Het
Rprd1a A T 18: 24,507,200 L173* probably null Het
Slfn3 A G 11: 83,212,683 I127V probably benign Het
Sp100 A G 1: 85,703,489 probably benign Het
Tbx15 T G 3: 99,352,511 M566R probably damaging Het
Tmem132a A G 19: 10,860,137 V603A probably damaging Het
Tob2 G T 15: 81,851,722 Y15* probably null Het
Trim23 A T 13: 104,192,075 Q307L probably damaging Het
Trpc4 A T 3: 54,222,283 I157L probably damaging Het
Tsen34 A T 7: 3,694,995 K87N possibly damaging Het
Ubr5 A G 15: 37,989,345 S2076P probably damaging Het
Vmn2r59 C T 7: 42,046,146 V281I probably benign Het
Vwa3b T C 1: 37,143,069 probably benign Het
Zfp384 C T 6: 125,036,649 P544L probably benign Het
Other mutations in Tesmin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02552:Tesmin APN 19 3402483 unclassified probably benign
R0207:Tesmin UTSW 19 3404088 missense probably benign 0.00
R5139:Tesmin UTSW 19 3406934 missense probably damaging 1.00
R5272:Tesmin UTSW 19 3406992 missense probably damaging 1.00
R6077:Tesmin UTSW 19 3389260 missense possibly damaging 0.49
R7246:Tesmin UTSW 19 3406965 missense probably damaging 1.00
R7357:Tesmin UTSW 19 3397042 missense probably benign 0.04
R7567:Tesmin UTSW 19 3392218 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTTAGAAGACATCACACCCCTG -3'
(R):5'- AGAGGTGAGACAGACTATGCTC -3'

Sequencing Primer
(F):5'- ACACCCCTGCTTCCAATTCTAATG -3'
(R):5'- GAGACAGACTATGCTCTTCAGTCAG -3'
Posted On2014-11-12