Incidental Mutation 'R2441:Chuk'
ID249804
Institutional Source Beutler Lab
Gene Symbol Chuk
Ensembl Gene ENSMUSG00000025199
Gene Nameconserved helix-loop-helix ubiquitous kinase
SynonymsChuk1, IKK 1, IKK alpha, IkappaB kinase alpha, IKKalpha, IKK-1, IKK-alpha, IKK[a], IKK1
MMRRC Submission 040399-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2441 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location44073335-44107480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44096921 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 262 (N262I)
Ref Sequence ENSEMBL: ENSMUSP00000026217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026217] [ENSMUST00000119591]
Predicted Effect probably damaging
Transcript: ENSMUST00000026217
AA Change: N262I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026217
Gene: ENSMUSG00000025199
AA Change: N262I

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 254 3.5e-39 PFAM
Pfam:Pkinase 15 298 8.3e-55 PFAM
Blast:PHB 589 659 1e-38 BLAST
IKKbetaNEMObind 706 743 1.64e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119591
AA Change: N262I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113809
Gene: ENSMUSG00000025199
AA Change: N262I

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 253 9.1e-38 PFAM
Pfam:Pkinase 15 298 8.5e-54 PFAM
Blast:PHB 589 659 8e-39 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146861
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147423
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. The encoded protein, a component of a cytokine-activated protein complex that is an inhibitor of the essential transcription factor NF-kappa-B complex, phosphorylates sites that trigger the degradation of the inhibitor via the ubiquination pathway, thereby activating the transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die neonataly and exhibit thickened, taut, adhesive skin that prevents appendages from protruding from the trunk, absence of whiskers, skeletal abnormalities, and closed esophagus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,492 N172S possibly damaging Het
AY358078 A G 14: 51,800,089 H15R probably benign Het
Boc A G 16: 44,488,623 V842A probably damaging Het
Erich6 A T 3: 58,618,811 L590Q probably damaging Het
Fsip2 A T 2: 82,985,341 H3806L possibly damaging Het
Gucy1b1 T C 3: 82,045,454 D224G probably damaging Het
Hgf A T 5: 16,604,790 H426L probably damaging Het
Nrxn2 G T 19: 6,428,301 G85W probably damaging Het
Ntrk3 A T 7: 78,302,662 N602K probably damaging Het
Olfr470 T C 7: 107,844,978 T252A probably benign Het
Olfr62 G A 4: 118,666,135 G206D possibly damaging Het
P3h4 G A 11: 100,413,768 R216W probably damaging Het
Pced1b T A 15: 97,384,285 D68E possibly damaging Het
Pzp A T 6: 128,489,768 L1161* probably null Het
Rprd1a A T 18: 24,507,200 L173* probably null Het
Slfn3 A G 11: 83,212,683 I127V probably benign Het
Sp100 A G 1: 85,703,489 probably benign Het
Tbx15 T G 3: 99,352,511 M566R probably damaging Het
Tesmin G A 19: 3,402,577 probably null Het
Tmem132a A G 19: 10,860,137 V603A probably damaging Het
Tob2 G T 15: 81,851,722 Y15* probably null Het
Trim23 A T 13: 104,192,075 Q307L probably damaging Het
Trpc4 A T 3: 54,222,283 I157L probably damaging Het
Tsen34 A T 7: 3,694,995 K87N possibly damaging Het
Ubr5 A G 15: 37,989,345 S2076P probably damaging Het
Vmn2r59 C T 7: 42,046,146 V281I probably benign Het
Vwa3b T C 1: 37,143,069 probably benign Het
Zfp384 C T 6: 125,036,649 P544L probably benign Het
Other mutations in Chuk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Chuk APN 19 44088023 missense possibly damaging 0.56
IGL00585:Chuk APN 19 44078312 missense probably damaging 0.99
IGL00662:Chuk APN 19 44097210 missense possibly damaging 0.64
IGL01419:Chuk APN 19 44096981 missense probably damaging 1.00
IGL01728:Chuk APN 19 44098646 missense possibly damaging 0.94
IGL01753:Chuk APN 19 44098576 splice site probably benign
PIT4362001:Chuk UTSW 19 44098583 critical splice donor site probably null
PIT4382001:Chuk UTSW 19 44098607 missense probably damaging 0.99
R0107:Chuk UTSW 19 44096919 missense probably damaging 1.00
R0107:Chuk UTSW 19 44096919 missense probably damaging 1.00
R0504:Chuk UTSW 19 44081938 splice site probably benign
R0731:Chuk UTSW 19 44103766 splice site probably benign
R0846:Chuk UTSW 19 44091028 missense probably damaging 1.00
R1433:Chuk UTSW 19 44078958 missense probably null 1.00
R1585:Chuk UTSW 19 44077373 missense possibly damaging 0.89
R2020:Chuk UTSW 19 44107343 missense possibly damaging 0.59
R2179:Chuk UTSW 19 44103721 missense possibly damaging 0.95
R4125:Chuk UTSW 19 44100174 missense probably null 0.00
R4180:Chuk UTSW 19 44101840 missense probably benign 0.01
R4746:Chuk UTSW 19 44088771 missense possibly damaging 0.86
R4815:Chuk UTSW 19 44077247 nonsense probably null
R4852:Chuk UTSW 19 44088758 missense possibly damaging 0.91
R5330:Chuk UTSW 19 44078955 missense probably damaging 1.00
R5331:Chuk UTSW 19 44078955 missense probably damaging 1.00
R5517:Chuk UTSW 19 44097533 critical splice acceptor site probably null
R5854:Chuk UTSW 19 44081957 missense probably benign 0.00
R6149:Chuk UTSW 19 44101831 missense probably damaging 1.00
R6161:Chuk UTSW 19 44082637 missense probably damaging 1.00
R6232:Chuk UTSW 19 44096992 missense probably benign 0.21
R6768:Chuk UTSW 19 44096951 missense probably damaging 0.96
R6865:Chuk UTSW 19 44086915 nonsense probably null
R7916:Chuk UTSW 19 44096981 missense probably damaging 1.00
R8038:Chuk UTSW 19 44078977 missense probably damaging 1.00
R8064:Chuk UTSW 19 44082676 missense probably damaging 1.00
R8187:Chuk UTSW 19 44091112 missense probably benign 0.05
R8272:Chuk UTSW 19 44103736 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TCCCACATCTGTGTTATCCAATAGG -3'
(R):5'- TGGGATTACATGGTGAGAAGCC -3'

Sequencing Primer
(F):5'- TAGGATAATCACTAAGCACAGTGC -3'
(R):5'- TTACATGGTGAGAAGCCTTGAG -3'
Posted On2014-11-12