Incidental Mutation 'R2442:Olfr1263'
ID249806
Institutional Source Beutler Lab
Gene Symbol Olfr1263
Ensembl Gene ENSMUSG00000059112
Gene Nameolfactory receptor 1263
SynonymsMOR234-2, GA_x6K02T2Q125-51447049-51447969
MMRRC Submission 040400-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R2442 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location90012131-90018424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90015341 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 137 (V137A)
Ref Sequence ENSEMBL: ENSMUSP00000150959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111507] [ENSMUST00000214382] [ENSMUST00000216616] [ENSMUST00000217065]
Predicted Effect probably benign
Transcript: ENSMUST00000111507
AA Change: V137A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107132
Gene: ENSMUSG00000059112
AA Change: V137A

DomainStartEndE-ValueType
Pfam:7tm_4 25 299 7.6e-42 PFAM
Pfam:7TM_GPCR_Srsx 30 297 1.7e-5 PFAM
Pfam:7tm_1 36 282 2.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214382
AA Change: V137A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216764
Predicted Effect probably benign
Transcript: ENSMUST00000217065
AA Change: V137A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,328,632 V256A probably benign Het
Acap1 T C 11: 69,889,491 N42S possibly damaging Het
Apoo-ps C A 13: 107,414,640 noncoding transcript Het
Bri3 C T 5: 144,244,601 T39I probably benign Het
Bsn A G 9: 108,106,920 S3312P unknown Het
Camkmt C A 17: 85,090,775 A17E possibly damaging Het
Cc2d2a G T 5: 43,671,305 probably null Het
Ccdc122 G T 14: 77,091,958 M150I possibly damaging Het
Celf4 A G 18: 25,753,459 F57L probably damaging Het
Cep192 T A 18: 67,824,688 F564Y possibly damaging Het
Ces1c T C 8: 93,123,212 D38G probably damaging Het
Cts7 C A 13: 61,355,617 G178* probably null Het
Dcc A T 18: 71,456,883 Y681N probably damaging Het
Dhx29 A G 13: 112,946,974 E521G possibly damaging Het
Dnase2a T C 8: 84,908,993 V35A probably damaging Het
Eif3l A G 15: 79,085,607 M268V probably damaging Het
Foxc1 A G 13: 31,808,798 M531V unknown Het
Grin2c A G 11: 115,251,134 Y820H probably damaging Het
Ifit1bl1 G A 19: 34,594,889 A56V probably benign Het
Iqsec1 T C 6: 90,689,883 E524G possibly damaging Het
Kcnt2 A G 1: 140,376,353 I154V possibly damaging Het
Kdm1b T A 13: 47,062,975 Y274N probably benign Het
Kntc1 T A 5: 123,810,859 L1889Q probably damaging Het
Lama1 A G 17: 67,768,317 T1010A probably benign Het
Mmp11 T C 10: 75,927,245 N171S probably benign Het
Myom1 A G 17: 71,110,735 E1409G probably damaging Het
N4bp1 A G 8: 86,862,040 I90T probably damaging Het
Plcb4 T C 2: 135,950,382 S342P probably damaging Het
Plg A G 17: 12,410,960 E627G probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc7a14 A G 3: 31,230,320 I289T probably damaging Het
Srpr G A 9: 35,212,001 G43S possibly damaging Het
Tbc1d9 T C 8: 83,166,076 M1T probably null Het
Tcte2 A T 17: 13,714,077 I90N possibly damaging Het
Trim30c G A 7: 104,382,274 P445S probably damaging Het
Trrap A G 5: 144,817,966 Q1984R probably damaging Het
Ubn2 T C 6: 38,491,005 S885P probably benign Het
Unc45a A G 7: 80,339,669 F17S probably damaging Het
Uts2b C T 16: 27,361,032 V75I probably benign Het
Vmn2r103 A G 17: 19,773,531 K57E probably benign Het
Vmn2r82 A G 10: 79,385,376 S524G probably damaging Het
Other mutations in Olfr1263
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Olfr1263 APN 2 90015719 missense probably damaging 1.00
IGL01512:Olfr1263 APN 2 90015292 missense probably damaging 1.00
IGL01722:Olfr1263 APN 2 90015007 missense probably benign 0.39
IGL01787:Olfr1263 APN 2 90015311 missense probably damaging 1.00
IGL02376:Olfr1263 APN 2 90015460 missense probably benign 0.00
IGL03408:Olfr1263 APN 2 90015571 missense probably benign 0.35
R0367:Olfr1263 UTSW 2 90015772 missense probably damaging 0.99
R0765:Olfr1263 UTSW 2 90015670 missense probably benign 0.01
R1158:Olfr1263 UTSW 2 90015254 missense possibly damaging 0.94
R1705:Olfr1263 UTSW 2 90015511 missense possibly damaging 0.90
R1794:Olfr1263 UTSW 2 90015020 missense probably damaging 1.00
R2197:Olfr1263 UTSW 2 90015424 missense probably damaging 1.00
R2347:Olfr1263 UTSW 2 90015614 missense possibly damaging 0.82
R3160:Olfr1263 UTSW 2 90015021 nonsense probably null
R3162:Olfr1263 UTSW 2 90015021 nonsense probably null
R4298:Olfr1263 UTSW 2 90015649 missense probably benign 0.13
R4898:Olfr1263 UTSW 2 90015418 missense probably damaging 1.00
R5340:Olfr1263 UTSW 2 90015362 missense probably benign
R6280:Olfr1263 UTSW 2 90015049 missense possibly damaging 0.62
R6367:Olfr1263 UTSW 2 90015016 missense probably benign 0.00
R6556:Olfr1263 UTSW 2 90015094 missense probably damaging 1.00
R7086:Olfr1263 UTSW 2 90015250 missense probably benign 0.07
R7502:Olfr1263 UTSW 2 90015011 missense probably benign 0.15
R7585:Olfr1263 UTSW 2 90015049 missense probably damaging 0.99
R8062:Olfr1263 UTSW 2 90015736 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGACCTAATCTCTGAGAAGAGCAC -3'
(R):5'- TTCTCAGGGAGCGAAGAATGAC -3'

Sequencing Primer
(F):5'- GAGCACCATATCCTTCAATGGCTG -3'
(R):5'- CTGTTGGCAGCGATCAGG -3'
Posted On2014-11-12