Incidental Mutation 'R2442:Sla2'
ID249808
Institutional Source Beutler Lab
Gene Symbol Sla2
Ensembl Gene ENSMUSG00000027636
Gene NameSrc-like-adaptor 2
SynonymsSLAP-2, A930009E21Rik, SLAP2
MMRRC Submission 040400-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2442 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location156872457-156887192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 156875942 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 137 (R137C)
Ref Sequence ENSEMBL: ENSMUSP00000105189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029164] [ENSMUST00000029165] [ENSMUST00000109561]
Predicted Effect probably damaging
Transcript: ENSMUST00000029164
AA Change: R137C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029164
Gene: ENSMUSG00000027636
AA Change: R137C

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
SH3 34 90 2.9e-4 SMART
SH2 91 181 4.47e-30 SMART
low complexity region 203 211 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029165
SMART Domains Protein: ENSMUSP00000029165
Gene: ENSMUSG00000027637

DomainStartEndE-ValueType
Pfam:Rab5ip 44 123 1.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109561
AA Change: R137C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105189
Gene: ENSMUSG00000027636
AA Change: R137C

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
SH3 34 90 2.9e-4 SMART
SH2 91 181 4.47e-30 SMART
low complexity region 203 211 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152551
Meta Mutation Damage Score 0.3138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLAP family of adapter proteins. The encoded protein may play an important receptor-proximal role in downregulating T and B cell-mediated responses and inhibits antigen receptor-induced calcium mobilization. This protein interacts with Cas-Br-M (murine) ecotropic retroviral transforming sequence c. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal B and T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,328,632 V256A probably benign Het
Acap1 T C 11: 69,889,491 N42S possibly damaging Het
Apoo-ps C A 13: 107,414,640 noncoding transcript Het
Bri3 C T 5: 144,244,601 T39I probably benign Het
Bsn A G 9: 108,106,920 S3312P unknown Het
Camkmt C A 17: 85,090,775 A17E possibly damaging Het
Cc2d2a G T 5: 43,671,305 probably null Het
Ccdc122 G T 14: 77,091,958 M150I possibly damaging Het
Celf4 A G 18: 25,753,459 F57L probably damaging Het
Cep192 T A 18: 67,824,688 F564Y possibly damaging Het
Ces1c T C 8: 93,123,212 D38G probably damaging Het
Cts7 C A 13: 61,355,617 G178* probably null Het
Dcc A T 18: 71,456,883 Y681N probably damaging Het
Dhx29 A G 13: 112,946,974 E521G possibly damaging Het
Dnase2a T C 8: 84,908,993 V35A probably damaging Het
Eif3l A G 15: 79,085,607 M268V probably damaging Het
Foxc1 A G 13: 31,808,798 M531V unknown Het
Grin2c A G 11: 115,251,134 Y820H probably damaging Het
Ifit1bl1 G A 19: 34,594,889 A56V probably benign Het
Iqsec1 T C 6: 90,689,883 E524G possibly damaging Het
Kcnt2 A G 1: 140,376,353 I154V possibly damaging Het
Kdm1b T A 13: 47,062,975 Y274N probably benign Het
Kntc1 T A 5: 123,810,859 L1889Q probably damaging Het
Lama1 A G 17: 67,768,317 T1010A probably benign Het
Mmp11 T C 10: 75,927,245 N171S probably benign Het
Myom1 A G 17: 71,110,735 E1409G probably damaging Het
N4bp1 A G 8: 86,862,040 I90T probably damaging Het
Olfr1263 T C 2: 90,015,341 V137A probably benign Het
Plcb4 T C 2: 135,950,382 S342P probably damaging Het
Plg A G 17: 12,410,960 E627G probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Slc7a14 A G 3: 31,230,320 I289T probably damaging Het
Srpr G A 9: 35,212,001 G43S possibly damaging Het
Tbc1d9 T C 8: 83,166,076 M1T probably null Het
Tcte2 A T 17: 13,714,077 I90N possibly damaging Het
Trim30c G A 7: 104,382,274 P445S probably damaging Het
Trrap A G 5: 144,817,966 Q1984R probably damaging Het
Ubn2 T C 6: 38,491,005 S885P probably benign Het
Unc45a A G 7: 80,339,669 F17S probably damaging Het
Uts2b C T 16: 27,361,032 V75I probably benign Het
Vmn2r103 A G 17: 19,773,531 K57E probably benign Het
Vmn2r82 A G 10: 79,385,376 S524G probably damaging Het
Other mutations in Sla2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0109:Sla2 UTSW 2 156883587 critical splice donor site probably null
R0109:Sla2 UTSW 2 156883587 critical splice donor site probably null
R0992:Sla2 UTSW 2 156874472 missense probably damaging 0.99
R2250:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2257:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2377:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2378:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2379:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2443:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R2843:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3416:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3417:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3499:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3792:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3793:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R3878:Sla2 UTSW 2 156875942 missense probably damaging 1.00
R5664:Sla2 UTSW 2 156874999 missense probably benign 0.04
R6784:Sla2 UTSW 2 156883669 missense unknown
R7356:Sla2 UTSW 2 156878703 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTCTAAGGGCACAACTGAC -3'
(R):5'- TTTAATGCTCACCCATCCTGAG -3'

Sequencing Primer
(F):5'- GGGCACAACTGACTATCTCCTAGG -3'
(R):5'- TGAGGACCACAGAATCCTATTAC -3'
Posted On2014-11-12