Incidental Mutation 'R0308:Rev3l'
ID 24981
Institutional Source Beutler Lab
Gene Symbol Rev3l
Ensembl Gene ENSMUSG00000019841
Gene Name REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms Sez4, Rev
MMRRC Submission 038518-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0308 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 39608114-39751207 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 39700890 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1796 (I1796V)
Ref Sequence ENSEMBL: ENSMUSP00000131519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019986] [ENSMUST00000131186] [ENSMUST00000139803] [ENSMUST00000164763]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000019986
AA Change: I1796V

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000019986
Gene: ENSMUSG00000019841
AA Change: I1796V

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 201 1.6e-10 PFAM
low complexity region 494 506 N/A INTRINSIC
low complexity region 959 969 N/A INTRINSIC
low complexity region 1042 1057 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3103 8.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131186
Predicted Effect probably benign
Transcript: ENSMUST00000139803
SMART Domains Protein: ENSMUSP00000115630
Gene: ENSMUSG00000019841

DomainStartEndE-ValueType
Blast:POLBc 1 369 1e-155 BLAST
POLBc 434 805 4.77e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145333
Predicted Effect probably benign
Transcript: ENSMUST00000164763
AA Change: I1796V

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131519
Gene: ENSMUSG00000019841
AA Change: I1796V

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 200 1.3e-11 PFAM
low complexity region 494 506 N/A INTRINSIC
Pfam:DUF4683 745 1132 1.7e-162 PFAM
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3102 6.1e-15 PFAM
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene represents the catalytic subunit of DNA polymerase zeta, which functions in translesion DNA synthesis. The encoded protein can be found in mitochondria, where it protects DNA from damage. Defects in this gene are a cause of Mobius syndrome. [provided by RefSeq, Jan 2017]
PHENOTYPE: Nullizygous mice exhibit complete embryonic lethality and abnormal embryonic tissue morphology with widespread degeneration and cell death. Mice carrying the amino acid substitution of phenylalanine for leucine at position 2610 display alterations in somatic hypermutation frequency and specificity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,989 (GRCm39) D65V probably damaging Het
4933407L21Rik A T 1: 85,859,007 (GRCm39) probably benign Het
Abcc12 C T 8: 87,284,381 (GRCm39) probably benign Het
Adamts12 A G 15: 11,311,646 (GRCm39) E1301G probably damaging Het
Adh4 A T 3: 138,129,863 (GRCm39) N230Y probably damaging Het
Anapc15-ps T A 10: 95,508,954 (GRCm39) M109L probably benign Het
Angpt2 T C 8: 18,742,141 (GRCm39) I472V possibly damaging Het
Arhgef26 C A 3: 62,247,820 (GRCm39) D301E probably benign Het
Armc10 G A 5: 21,852,295 (GRCm39) probably benign Het
Atm T C 9: 53,365,773 (GRCm39) probably null Het
Atp5f1b T C 10: 127,921,908 (GRCm39) V265A probably benign Het
Atp8b1 G T 18: 64,678,315 (GRCm39) C860* probably null Het
Atrnl1 T G 19: 57,741,720 (GRCm39) S1160A probably benign Het
Bmal1 A T 7: 112,890,743 (GRCm39) I179F probably damaging Het
Cep55 A G 19: 38,048,659 (GRCm39) E105G possibly damaging Het
Cfap54 C A 10: 92,721,226 (GRCm39) D2502Y unknown Het
Cilp2 A G 8: 70,335,643 (GRCm39) S452P probably benign Het
Clptm1l A G 13: 73,759,786 (GRCm39) D282G possibly damaging Het
Csrp1 C A 1: 135,673,024 (GRCm39) T47N probably damaging Het
Cyp2c40 T A 19: 39,766,432 (GRCm39) I388F probably damaging Het
Dars1 C T 1: 128,291,996 (GRCm39) R494H probably damaging Het
Dna2 T C 10: 62,792,753 (GRCm39) V256A probably damaging Het
Dock7 T C 4: 98,873,051 (GRCm39) T1132A probably benign Het
Dpcd T G 19: 45,565,445 (GRCm39) F140V probably damaging Het
Elk3 A T 10: 93,101,067 (GRCm39) M228K probably benign Het
Erich6 A G 3: 58,543,525 (GRCm39) F182L probably damaging Het
Fhad1 A G 4: 141,712,904 (GRCm39) probably benign Het
Fryl A T 5: 73,198,947 (GRCm39) probably benign Het
Fzd9 A T 5: 135,278,260 (GRCm39) C542S probably damaging Het
Gba1 A G 3: 89,115,671 (GRCm39) T460A probably benign Het
Gli2 C T 1: 118,769,792 (GRCm39) A587T probably benign Het
Gm11011 C T 2: 169,424,614 (GRCm39) probably benign Het
Gmppb A G 9: 107,927,033 (GRCm39) E68G probably benign Het
Gpld1 A G 13: 25,146,818 (GRCm39) N260S possibly damaging Het
Hipk3 G A 2: 104,263,552 (GRCm39) S900L probably damaging Het
Idi2l T G 13: 8,990,877 (GRCm39) probably benign Het
Ints6l A T X: 55,526,715 (GRCm39) M215L possibly damaging Het
Irx6 T A 8: 93,403,659 (GRCm39) L128Q probably damaging Het
Itga10 T C 3: 96,558,780 (GRCm39) S373P probably damaging Het
Jak1 T C 4: 101,011,732 (GRCm39) probably null Het
Jak2 C T 19: 29,289,157 (GRCm39) T1103I probably benign Het
Katnal1 A T 5: 148,815,734 (GRCm39) V401D possibly damaging Het
Krbox5 A G 13: 67,991,232 (GRCm39) probably benign Het
Lrp2 T A 2: 69,313,326 (GRCm39) probably benign Het
Map3k13 A G 16: 21,710,738 (GRCm39) H7R probably benign Het
Mrgprx3-ps A G 7: 46,959,766 (GRCm39) V75A probably benign Het
Nol6 C T 4: 41,123,584 (GRCm39) A55T probably benign Het
Opa1 G A 16: 29,440,349 (GRCm39) R818Q probably damaging Het
Opn4 T C 14: 34,319,081 (GRCm39) Y168C possibly damaging Het
Or8b35 A G 9: 37,904,141 (GRCm39) I118V probably benign Het
Phf21a T C 2: 92,161,122 (GRCm39) V330A possibly damaging Het
Phykpl A G 11: 51,484,423 (GRCm39) probably benign Het
Plcb1 T G 2: 134,655,534 (GRCm39) V38G probably benign Het
Plxna4 T A 6: 32,214,703 (GRCm39) T593S probably benign Het
Poll A T 19: 45,544,404 (GRCm39) I339N probably damaging Het
Rnf103 G A 6: 71,486,686 (GRCm39) R439H probably damaging Het
Rrn3 G A 16: 13,617,746 (GRCm39) probably benign Het
Sec14l4 G A 11: 3,991,726 (GRCm39) probably benign Het
Sec23a A C 12: 59,053,985 (GRCm39) Y4* probably null Het
Senp6 T C 9: 80,040,265 (GRCm39) probably null Het
Serpinb6b A T 13: 33,162,220 (GRCm39) N221Y probably benign Het
Slc6a2 A G 8: 93,687,988 (GRCm39) E38G possibly damaging Het
Smap1 A T 1: 23,888,423 (GRCm39) L196I probably damaging Het
Sorbs2 C T 8: 46,248,167 (GRCm39) Q473* probably null Het
Sphkap C A 1: 83,254,690 (GRCm39) V1020F probably damaging Het
Srfbp1 T C 18: 52,621,614 (GRCm39) V225A probably benign Het
Srprb G A 9: 103,079,204 (GRCm39) P728S possibly damaging Het
Tarm1 T C 7: 3,545,187 (GRCm39) probably benign Het
Tcp1 T A 17: 13,139,306 (GRCm39) I162N probably benign Het
Tmem237 C A 1: 59,146,676 (GRCm39) A292S probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Tnpo1 A G 13: 98,983,011 (GRCm39) F884L probably damaging Het
Trim7 A G 11: 48,740,328 (GRCm39) T142A probably damaging Het
Ttn T A 2: 76,616,024 (GRCm39) I14894F probably damaging Het
Tubgcp6 T C 15: 89,006,639 (GRCm39) R128G possibly damaging Het
Ube2d2b A G 5: 107,978,774 (GRCm39) T142A possibly damaging Het
Unc13c G T 9: 73,388,400 (GRCm39) L2129I probably benign Het
Ushbp1 T C 8: 71,843,697 (GRCm39) D247G probably damaging Het
Usp43 G A 11: 67,770,966 (GRCm39) A556V probably damaging Het
Zfp438 T A 18: 5,213,638 (GRCm39) H440L probably benign Het
Zfp518b C T 5: 38,830,113 (GRCm39) E631K possibly damaging Het
Other mutations in Rev3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Rev3l APN 10 39,682,965 (GRCm39) missense probably benign
IGL00815:Rev3l APN 10 39,735,149 (GRCm39) missense possibly damaging 0.79
IGL00964:Rev3l APN 10 39,740,802 (GRCm39) missense probably benign 0.39
IGL01765:Rev3l APN 10 39,704,261 (GRCm39) missense probably benign 0.00
IGL01792:Rev3l APN 10 39,699,336 (GRCm39) missense probably benign
IGL01950:Rev3l APN 10 39,697,153 (GRCm39) missense probably damaging 1.00
IGL01963:Rev3l APN 10 39,698,733 (GRCm39) missense possibly damaging 0.90
IGL02089:Rev3l APN 10 39,701,095 (GRCm39) missense probably damaging 1.00
IGL02288:Rev3l APN 10 39,704,212 (GRCm39) missense probably benign
IGL02381:Rev3l APN 10 39,697,342 (GRCm39) missense possibly damaging 0.83
IGL02409:Rev3l APN 10 39,697,144 (GRCm39) missense possibly damaging 0.75
IGL02434:Rev3l APN 10 39,698,587 (GRCm39) missense probably damaging 1.00
IGL02570:Rev3l APN 10 39,724,009 (GRCm39) missense possibly damaging 0.68
IGL02581:Rev3l APN 10 39,697,277 (GRCm39) missense probably benign 0.10
IGL02654:Rev3l APN 10 39,738,730 (GRCm39) missense probably damaging 1.00
IGL02720:Rev3l APN 10 39,698,391 (GRCm39) nonsense probably null
IGL02746:Rev3l APN 10 39,700,585 (GRCm39) missense probably damaging 0.99
IGL02829:Rev3l APN 10 39,701,236 (GRCm39) missense probably damaging 1.00
IGL02961:Rev3l APN 10 39,703,941 (GRCm39) missense possibly damaging 0.65
IGL02974:Rev3l APN 10 39,738,743 (GRCm39) nonsense probably null
IGL03029:Rev3l APN 10 39,704,482 (GRCm39) missense probably benign 0.34
IGL03153:Rev3l APN 10 39,682,874 (GRCm39) missense probably damaging 1.00
IGL03172:Rev3l APN 10 39,700,786 (GRCm39) missense probably benign 0.10
R0068:Rev3l UTSW 10 39,700,827 (GRCm39) missense possibly damaging 0.68
R0068:Rev3l UTSW 10 39,700,827 (GRCm39) missense possibly damaging 0.68
R0153:Rev3l UTSW 10 39,750,124 (GRCm39) nonsense probably null
R0355:Rev3l UTSW 10 39,693,282 (GRCm39) missense probably damaging 1.00
R0513:Rev3l UTSW 10 39,704,139 (GRCm39) missense probably benign 0.00
R0523:Rev3l UTSW 10 39,724,045 (GRCm39) missense probably benign 0.02
R0559:Rev3l UTSW 10 39,700,483 (GRCm39) missense probably damaging 1.00
R0761:Rev3l UTSW 10 39,750,191 (GRCm39) missense probably benign 0.32
R1023:Rev3l UTSW 10 39,708,635 (GRCm39) missense probably damaging 1.00
R1159:Rev3l UTSW 10 39,727,921 (GRCm39) nonsense probably null
R1398:Rev3l UTSW 10 39,697,579 (GRCm39) missense probably benign 0.05
R1478:Rev3l UTSW 10 39,659,329 (GRCm39) critical splice donor site probably null
R1517:Rev3l UTSW 10 39,714,439 (GRCm39) missense probably benign 0.34
R1527:Rev3l UTSW 10 39,698,818 (GRCm39) missense probably damaging 1.00
R1635:Rev3l UTSW 10 39,682,658 (GRCm39) missense probably damaging 0.98
R1695:Rev3l UTSW 10 39,700,612 (GRCm39) missense probably damaging 0.97
R1695:Rev3l UTSW 10 39,700,611 (GRCm39) nonsense probably null
R1782:Rev3l UTSW 10 39,675,881 (GRCm39) missense probably benign
R1815:Rev3l UTSW 10 39,698,867 (GRCm39) missense probably benign 0.41
R1818:Rev3l UTSW 10 39,704,420 (GRCm39) missense probably benign 0.05
R2039:Rev3l UTSW 10 39,700,440 (GRCm39) missense probably damaging 1.00
R2071:Rev3l UTSW 10 39,700,349 (GRCm39) missense probably benign 0.17
R2101:Rev3l UTSW 10 39,704,092 (GRCm39) missense probably benign 0.00
R2141:Rev3l UTSW 10 39,724,045 (GRCm39) missense probably benign 0.02
R2883:Rev3l UTSW 10 39,701,152 (GRCm39) missense probably damaging 1.00
R3787:Rev3l UTSW 10 39,722,206 (GRCm39) missense probably damaging 0.97
R3910:Rev3l UTSW 10 39,696,552 (GRCm39) missense probably damaging 1.00
R3912:Rev3l UTSW 10 39,696,552 (GRCm39) missense probably damaging 1.00
R3913:Rev3l UTSW 10 39,696,552 (GRCm39) missense probably damaging 1.00
R4590:Rev3l UTSW 10 39,682,929 (GRCm39) missense probably damaging 1.00
R4631:Rev3l UTSW 10 39,704,412 (GRCm39) missense probably benign 0.44
R4633:Rev3l UTSW 10 39,722,182 (GRCm39) missense probably damaging 1.00
R4707:Rev3l UTSW 10 39,699,393 (GRCm39) missense probably damaging 0.99
R4724:Rev3l UTSW 10 39,722,802 (GRCm39) nonsense probably null
R4810:Rev3l UTSW 10 39,699,721 (GRCm39) missense probably benign 0.01
R4857:Rev3l UTSW 10 39,714,455 (GRCm39) missense probably damaging 1.00
R4882:Rev3l UTSW 10 39,697,456 (GRCm39) missense possibly damaging 0.89
R4928:Rev3l UTSW 10 39,699,981 (GRCm39) missense probably benign 0.30
R4970:Rev3l UTSW 10 39,699,326 (GRCm39) missense probably benign 0.00
R4977:Rev3l UTSW 10 39,699,574 (GRCm39) missense possibly damaging 0.80
R5112:Rev3l UTSW 10 39,699,326 (GRCm39) missense probably benign 0.00
R5261:Rev3l UTSW 10 39,722,725 (GRCm39) missense probably damaging 1.00
R5419:Rev3l UTSW 10 39,700,927 (GRCm39) missense possibly damaging 0.95
R5570:Rev3l UTSW 10 39,728,071 (GRCm39) critical splice donor site probably null
R5628:Rev3l UTSW 10 39,698,963 (GRCm39) missense probably damaging 0.98
R5689:Rev3l UTSW 10 39,670,954 (GRCm39) missense probably damaging 1.00
R5781:Rev3l UTSW 10 39,699,089 (GRCm39) missense probably benign 0.00
R5829:Rev3l UTSW 10 39,682,902 (GRCm39) missense probably damaging 0.97
R5984:Rev3l UTSW 10 39,618,685 (GRCm39) intron probably benign
R5990:Rev3l UTSW 10 39,699,807 (GRCm39) missense probably benign 0.17
R6054:Rev3l UTSW 10 39,700,146 (GRCm39) missense probably benign 0.01
R6171:Rev3l UTSW 10 39,738,709 (GRCm39) nonsense probably null
R6220:Rev3l UTSW 10 39,698,775 (GRCm39) missense probably damaging 1.00
R6520:Rev3l UTSW 10 39,698,698 (GRCm39) missense probably benign 0.06
R6798:Rev3l UTSW 10 39,730,759 (GRCm39) missense probably damaging 1.00
R6811:Rev3l UTSW 10 39,706,917 (GRCm39) nonsense probably null
R6812:Rev3l UTSW 10 39,699,544 (GRCm39) missense probably benign
R6904:Rev3l UTSW 10 39,697,477 (GRCm39) missense probably benign
R6905:Rev3l UTSW 10 39,693,323 (GRCm39) missense probably benign 0.18
R6938:Rev3l UTSW 10 39,738,706 (GRCm39) missense probably damaging 1.00
R7037:Rev3l UTSW 10 39,727,971 (GRCm39) missense probably damaging 1.00
R7124:Rev3l UTSW 10 39,698,163 (GRCm39) nonsense probably null
R7286:Rev3l UTSW 10 39,699,601 (GRCm39) missense probably damaging 0.99
R7385:Rev3l UTSW 10 39,699,678 (GRCm39) missense probably benign 0.01
R7575:Rev3l UTSW 10 39,697,441 (GRCm39) missense possibly damaging 0.56
R7596:Rev3l UTSW 10 39,697,534 (GRCm39) missense probably damaging 1.00
R7597:Rev3l UTSW 10 39,698,880 (GRCm39) missense probably damaging 1.00
R7670:Rev3l UTSW 10 39,712,718 (GRCm39) missense probably benign 0.01
R7804:Rev3l UTSW 10 39,699,481 (GRCm39) missense probably benign 0.34
R7818:Rev3l UTSW 10 39,699,898 (GRCm39) missense possibly damaging 0.54
R7874:Rev3l UTSW 10 39,698,491 (GRCm39) missense possibly damaging 0.72
R7991:Rev3l UTSW 10 39,739,734 (GRCm39) missense possibly damaging 0.52
R8059:Rev3l UTSW 10 39,719,491 (GRCm39) missense probably damaging 1.00
R8174:Rev3l UTSW 10 39,735,111 (GRCm39) missense probably damaging 1.00
R8187:Rev3l UTSW 10 39,682,693 (GRCm39) missense probably benign
R8299:Rev3l UTSW 10 39,697,537 (GRCm39) missense probably benign 0.01
R8352:Rev3l UTSW 10 39,698,899 (GRCm39) missense probably damaging 1.00
R8452:Rev3l UTSW 10 39,698,899 (GRCm39) missense probably damaging 1.00
R8468:Rev3l UTSW 10 39,703,987 (GRCm39) missense probably damaging 0.99
R8487:Rev3l UTSW 10 39,682,844 (GRCm39) missense probably damaging 1.00
R8512:Rev3l UTSW 10 39,697,534 (GRCm39) missense probably damaging 1.00
R8554:Rev3l UTSW 10 39,682,838 (GRCm39) missense probably benign 0.12
R8702:Rev3l UTSW 10 39,714,465 (GRCm39) nonsense probably null
R8848:Rev3l UTSW 10 39,722,705 (GRCm39) missense probably damaging 0.99
R8857:Rev3l UTSW 10 39,670,965 (GRCm39) nonsense probably null
R8870:Rev3l UTSW 10 39,738,786 (GRCm39) missense probably damaging 1.00
R9094:Rev3l UTSW 10 39,700,809 (GRCm39) missense probably benign
R9175:Rev3l UTSW 10 39,730,764 (GRCm39) missense possibly damaging 0.83
R9286:Rev3l UTSW 10 39,682,947 (GRCm39) missense possibly damaging 0.54
R9299:Rev3l UTSW 10 39,723,999 (GRCm39) missense probably damaging 1.00
R9307:Rev3l UTSW 10 39,693,149 (GRCm39) missense probably benign 0.01
R9337:Rev3l UTSW 10 39,698,850 (GRCm39) missense probably benign 0.40
R9342:Rev3l UTSW 10 39,697,458 (GRCm39) missense probably benign
R9389:Rev3l UTSW 10 39,698,967 (GRCm39) missense possibly damaging 0.47
R9395:Rev3l UTSW 10 39,735,219 (GRCm39) critical splice donor site probably null
R9458:Rev3l UTSW 10 39,659,247 (GRCm39) missense probably damaging 1.00
R9481:Rev3l UTSW 10 39,701,033 (GRCm39) missense probably benign
R9646:Rev3l UTSW 10 39,698,440 (GRCm39) missense probably damaging 1.00
R9686:Rev3l UTSW 10 39,743,384 (GRCm39) missense possibly damaging 0.67
X0022:Rev3l UTSW 10 39,704,603 (GRCm39) critical splice donor site probably null
Z1088:Rev3l UTSW 10 39,700,314 (GRCm39) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TGAGAATCATCGGCACAGCCAG -3'
(R):5'- TGGCACATCCGAAGGATTACTGC -3'

Sequencing Primer
(F):5'- GCCAGTGGAAAAATAGCTTTCATCC -3'
(R):5'- GGATTACTGCAAAATGGTTCCTG -3'
Posted On 2013-04-16