Incidental Mutation 'R2442:Unc45a'
ID249817
Institutional Source Beutler Lab
Gene Symbol Unc45a
Ensembl Gene ENSMUSG00000030533
Gene Nameunc-45 myosin chaperone A
Synonyms
MMRRC Submission 040400-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2442 (G1)
Quality Score211
Status Not validated
Chromosome7
Chromosomal Location80325292-80341005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80339669 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 17 (F17S)
Ref Sequence ENSEMBL: ENSMUSP00000114428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032747] [ENSMUST00000032748] [ENSMUST00000107368] [ENSMUST00000127997] [ENSMUST00000133728] [ENSMUST00000154428] [ENSMUST00000205531] [ENSMUST00000205744] [ENSMUST00000205768] [ENSMUST00000206074] [ENSMUST00000206089] [ENSMUST00000206122] [ENSMUST00000206480]
Predicted Effect probably benign
Transcript: ENSMUST00000032747
SMART Domains Protein: ENSMUSP00000032747
Gene: ENSMUSG00000030532

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
HDc 28 136 1.01e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000032748
AA Change: F32S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032748
Gene: ENSMUSG00000030533
AA Change: F32S

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 287 505 1.2e-43 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107368
AA Change: F32S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102991
Gene: ENSMUSG00000030533
AA Change: F32S

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 314 505 2.4e-38 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127997
AA Change: F17S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114428
Gene: ENSMUSG00000030533
AA Change: F17S

DomainStartEndE-ValueType
Pfam:TPR_11 4 74 8.4e-19 PFAM
Pfam:TPR_1 6 36 2.3e-6 PFAM
Pfam:TPR_2 6 37 2.6e-6 PFAM
Pfam:TPR_16 10 82 1e-7 PFAM
Pfam:TPR_1 43 69 4.4e-4 PFAM
Pfam:TPR_2 43 74 3.1e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133728
AA Change: F17S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123399
Gene: ENSMUSG00000030533
AA Change: F17S

DomainStartEndE-ValueType
TPR 6 39 9.53e-2 SMART
TPR 43 76 5.48e-2 SMART
TPR 77 110 7.45e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145351
Predicted Effect probably damaging
Transcript: ENSMUST00000154428
AA Change: F32S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119665
Gene: ENSMUSG00000030533
AA Change: F32S

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 4e-9 BLAST
Blast:ARM 226 266 6e-8 BLAST
Pfam:UNC45-central 287 505 3.5e-44 PFAM
low complexity region 597 608 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205448
Predicted Effect probably benign
Transcript: ENSMUST00000205531
Predicted Effect probably benign
Transcript: ENSMUST00000205744
Predicted Effect probably benign
Transcript: ENSMUST00000205768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206032
Predicted Effect probably benign
Transcript: ENSMUST00000206074
Predicted Effect probably benign
Transcript: ENSMUST00000206089
Predicted Effect probably benign
Transcript: ENSMUST00000206122
Predicted Effect probably benign
Transcript: ENSMUST00000206480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206494
Predicted Effect probably benign
Transcript: ENSMUST00000206559
Predicted Effect probably benign
Transcript: ENSMUST00000206363
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UNC45A plays a role in cell proliferation and myoblast fusion, binds progesterone receptor (PGR; MIM 607311) and HSP90 (HSPCA; MIM 140571), and acts as a regulator of the progesterone receptor chaperoning pathway (Price et al., 2002 [PubMed 12356907]; Chadli et al., 2006 [PubMed 16478993]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,328,632 V256A probably benign Het
Acap1 T C 11: 69,889,491 N42S possibly damaging Het
Apoo-ps C A 13: 107,414,640 noncoding transcript Het
Bri3 C T 5: 144,244,601 T39I probably benign Het
Bsn A G 9: 108,106,920 S3312P unknown Het
Camkmt C A 17: 85,090,775 A17E possibly damaging Het
Cc2d2a G T 5: 43,671,305 probably null Het
Ccdc122 G T 14: 77,091,958 M150I possibly damaging Het
Celf4 A G 18: 25,753,459 F57L probably damaging Het
Cep192 T A 18: 67,824,688 F564Y possibly damaging Het
Ces1c T C 8: 93,123,212 D38G probably damaging Het
Cts7 C A 13: 61,355,617 G178* probably null Het
Dcc A T 18: 71,456,883 Y681N probably damaging Het
Dhx29 A G 13: 112,946,974 E521G possibly damaging Het
Dnase2a T C 8: 84,908,993 V35A probably damaging Het
Eif3l A G 15: 79,085,607 M268V probably damaging Het
Foxc1 A G 13: 31,808,798 M531V unknown Het
Grin2c A G 11: 115,251,134 Y820H probably damaging Het
Ifit1bl1 G A 19: 34,594,889 A56V probably benign Het
Iqsec1 T C 6: 90,689,883 E524G possibly damaging Het
Kcnt2 A G 1: 140,376,353 I154V possibly damaging Het
Kdm1b T A 13: 47,062,975 Y274N probably benign Het
Kntc1 T A 5: 123,810,859 L1889Q probably damaging Het
Lama1 A G 17: 67,768,317 T1010A probably benign Het
Mmp11 T C 10: 75,927,245 N171S probably benign Het
Myom1 A G 17: 71,110,735 E1409G probably damaging Het
N4bp1 A G 8: 86,862,040 I90T probably damaging Het
Olfr1263 T C 2: 90,015,341 V137A probably benign Het
Plcb4 T C 2: 135,950,382 S342P probably damaging Het
Plg A G 17: 12,410,960 E627G probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc7a14 A G 3: 31,230,320 I289T probably damaging Het
Srpr G A 9: 35,212,001 G43S possibly damaging Het
Tbc1d9 T C 8: 83,166,076 M1T probably null Het
Tcte2 A T 17: 13,714,077 I90N possibly damaging Het
Trim30c G A 7: 104,382,274 P445S probably damaging Het
Trrap A G 5: 144,817,966 Q1984R probably damaging Het
Ubn2 T C 6: 38,491,005 S885P probably benign Het
Uts2b C T 16: 27,361,032 V75I probably benign Het
Vmn2r103 A G 17: 19,773,531 K57E probably benign Het
Vmn2r82 A G 10: 79,385,376 S524G probably damaging Het
Other mutations in Unc45a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02252:Unc45a APN 7 80332969 intron probably benign
IGL02266:Unc45a APN 7 80328486 missense probably damaging 0.96
IGL02383:Unc45a APN 7 80339662 nonsense probably null
IGL02959:Unc45a APN 7 80332973 intron probably benign
IGL03168:Unc45a APN 7 80333133 missense probably damaging 1.00
PIT4131001:Unc45a UTSW 7 80326361 missense possibly damaging 0.74
R0095:Unc45a UTSW 7 80329543 missense probably damaging 1.00
R0095:Unc45a UTSW 7 80329543 missense probably damaging 1.00
R0276:Unc45a UTSW 7 80326297 intron probably benign
R0373:Unc45a UTSW 7 80326344 missense probably damaging 0.97
R1827:Unc45a UTSW 7 80331740 missense possibly damaging 0.77
R2120:Unc45a UTSW 7 80340098 missense probably benign 0.29
R2440:Unc45a UTSW 7 80329057 missense probably damaging 1.00
R2508:Unc45a UTSW 7 80338875 missense probably benign
R3077:Unc45a UTSW 7 80338932 missense probably damaging 0.97
R3108:Unc45a UTSW 7 80331546 intron probably benign
R3109:Unc45a UTSW 7 80331546 intron probably benign
R3620:Unc45a UTSW 7 80334051 missense possibly damaging 0.84
R4471:Unc45a UTSW 7 80332980 missense possibly damaging 0.94
R4644:Unc45a UTSW 7 80328509 missense probably damaging 1.00
R4651:Unc45a UTSW 7 80333029 missense possibly damaging 0.93
R4838:Unc45a UTSW 7 80333035 missense probably damaging 1.00
R5234:Unc45a UTSW 7 80328799 missense probably benign 0.17
R5452:Unc45a UTSW 7 80329039 missense probably damaging 1.00
R5574:Unc45a UTSW 7 80334856 missense probably damaging 0.98
R5750:Unc45a UTSW 7 80334823 missense probably benign 0.17
R6169:Unc45a UTSW 7 80328763 missense possibly damaging 0.92
R6417:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6420:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6486:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6533:Unc45a UTSW 7 80334069 missense probably damaging 1.00
R6734:Unc45a UTSW 7 80336998 missense probably damaging 1.00
R6993:Unc45a UTSW 7 80325655 missense probably damaging 1.00
R7085:Unc45a UTSW 7 80326334 missense possibly damaging 0.87
R7180:Unc45a UTSW 7 80329821 splice site probably null
R7561:Unc45a UTSW 7 80331586 missense possibly damaging 0.63
R8079:Unc45a UTSW 7 80331562 missense probably damaging 1.00
R8395:Unc45a UTSW 7 80326332 missense probably benign 0.08
R8547:Unc45a UTSW 7 80326092 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TGCCCAACTGGTGCACAAAC -3'
(R):5'- GGTCGCCGTCACCTTATTCTAG -3'

Sequencing Primer
(F):5'- GCAGCGGCTATGGGCAATC -3'
(R):5'- TTCACGGGACTCGGCCAAG -3'
Posted On2014-11-12