Incidental Mutation 'R2442:Trim30c'
ID249819
Institutional Source Beutler Lab
Gene Symbol Trim30c
Ensembl Gene ENSMUSG00000078616
Gene Nametripartite motif-containing 30C
SynonymsGm5598, Trim30-2
MMRRC Submission 040400-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R2442 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104382065-104400837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104382274 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 445 (P445S)
Ref Sequence ENSEMBL: ENSMUSP00000102441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106828]
Predicted Effect probably damaging
Transcript: ENSMUST00000106828
AA Change: P445S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102441
Gene: ENSMUSG00000078616
AA Change: P445S

DomainStartEndE-ValueType
RING 16 59 2.51e-10 SMART
BBOX 92 133 2.02e-14 SMART
low complexity region 197 229 N/A INTRINSIC
Pfam:SPRY 356 495 1.9e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,328,632 V256A probably benign Het
Acap1 T C 11: 69,889,491 N42S possibly damaging Het
Apoo-ps C A 13: 107,414,640 noncoding transcript Het
Bri3 C T 5: 144,244,601 T39I probably benign Het
Bsn A G 9: 108,106,920 S3312P unknown Het
Camkmt C A 17: 85,090,775 A17E possibly damaging Het
Cc2d2a G T 5: 43,671,305 probably null Het
Ccdc122 G T 14: 77,091,958 M150I possibly damaging Het
Celf4 A G 18: 25,753,459 F57L probably damaging Het
Cep192 T A 18: 67,824,688 F564Y possibly damaging Het
Ces1c T C 8: 93,123,212 D38G probably damaging Het
Cts7 C A 13: 61,355,617 G178* probably null Het
Dcc A T 18: 71,456,883 Y681N probably damaging Het
Dhx29 A G 13: 112,946,974 E521G possibly damaging Het
Dnase2a T C 8: 84,908,993 V35A probably damaging Het
Eif3l A G 15: 79,085,607 M268V probably damaging Het
Foxc1 A G 13: 31,808,798 M531V unknown Het
Grin2c A G 11: 115,251,134 Y820H probably damaging Het
Ifit1bl1 G A 19: 34,594,889 A56V probably benign Het
Iqsec1 T C 6: 90,689,883 E524G possibly damaging Het
Kcnt2 A G 1: 140,376,353 I154V possibly damaging Het
Kdm1b T A 13: 47,062,975 Y274N probably benign Het
Kntc1 T A 5: 123,810,859 L1889Q probably damaging Het
Lama1 A G 17: 67,768,317 T1010A probably benign Het
Mmp11 T C 10: 75,927,245 N171S probably benign Het
Myom1 A G 17: 71,110,735 E1409G probably damaging Het
N4bp1 A G 8: 86,862,040 I90T probably damaging Het
Olfr1263 T C 2: 90,015,341 V137A probably benign Het
Plcb4 T C 2: 135,950,382 S342P probably damaging Het
Plg A G 17: 12,410,960 E627G probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc7a14 A G 3: 31,230,320 I289T probably damaging Het
Srpr G A 9: 35,212,001 G43S possibly damaging Het
Tbc1d9 T C 8: 83,166,076 M1T probably null Het
Tcte2 A T 17: 13,714,077 I90N possibly damaging Het
Trrap A G 5: 144,817,966 Q1984R probably damaging Het
Ubn2 T C 6: 38,491,005 S885P probably benign Het
Unc45a A G 7: 80,339,669 F17S probably damaging Het
Uts2b C T 16: 27,361,032 V75I probably benign Het
Vmn2r103 A G 17: 19,773,531 K57E probably benign Het
Vmn2r82 A G 10: 79,385,376 S524G probably damaging Het
Other mutations in Trim30c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Trim30c APN 7 104382182 nonsense probably null
IGL00573:Trim30c APN 7 104382631 missense possibly damaging 0.66
IGL01023:Trim30c APN 7 104382972 splice site probably benign
IGL01413:Trim30c APN 7 104382334 missense possibly damaging 0.85
IGL01418:Trim30c APN 7 104382334 missense possibly damaging 0.85
IGL02330:Trim30c APN 7 104382958 missense possibly damaging 0.61
IGL02389:Trim30c APN 7 104382174 missense probably benign 0.00
IGL03107:Trim30c APN 7 104382613 missense possibly damaging 0.95
R0195:Trim30c UTSW 7 104382429 missense probably benign
R0324:Trim30c UTSW 7 104383309 missense possibly damaging 0.79
R0826:Trim30c UTSW 7 104383481 missense probably benign 0.01
R0865:Trim30c UTSW 7 104390451 missense probably damaging 1.00
R1484:Trim30c UTSW 7 104383252 missense probably benign 0.00
R1513:Trim30c UTSW 7 104382689 missense probably benign 0.04
R1563:Trim30c UTSW 7 104382951 missense probably benign 0.00
R2220:Trim30c UTSW 7 104383267 missense probably benign
R5326:Trim30c UTSW 7 104388304 missense possibly damaging 0.89
R5777:Trim30c UTSW 7 104383331 missense probably benign 0.08
R6118:Trim30c UTSW 7 104382081 missense probably benign 0.01
R6257:Trim30c UTSW 7 104390168 missense probably damaging 1.00
R6374:Trim30c UTSW 7 104390402 missense probably benign 0.01
R7387:Trim30c UTSW 7 104390190 missense probably damaging 1.00
R7419:Trim30c UTSW 7 104388265 missense probably benign 0.11
R7500:Trim30c UTSW 7 104387551 missense probably benign 0.00
R7542:Trim30c UTSW 7 104382218 missense possibly damaging 0.95
Z1176:Trim30c UTSW 7 104383258 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCCCACATACTGTCATTGGC -3'
(R):5'- ACCTGGATCCTGGGATTAAATGATG -3'

Sequencing Primer
(F):5'- TGGCTCTGAACATTCCATAGG -3'
(R):5'- GATGGACTGTGTGTTCAACCTCAAC -3'
Posted On2014-11-12