Incidental Mutation 'R2442:Tbc1d9'
ID249820
Institutional Source Beutler Lab
Gene Symbol Tbc1d9
Ensembl Gene ENSMUSG00000031709
Gene NameTBC1 domain family, member 9
Synonyms4933431N12Rik, C76116
MMRRC Submission 040400-MU
Accession Numbers

Genbank: NM_001111304.1, NM_027758.4

Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R2442 (G1)
Quality Score152
Status Not validated
Chromosome8
Chromosomal Location83165352-83272934 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 83166076 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000091093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034145] [ENSMUST00000093393] [ENSMUST00000098605]
Predicted Effect probably null
Transcript: ENSMUST00000034145
AA Change: M1T

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034145
Gene: ENSMUSG00000031709
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 31 55 N/A INTRINSIC
low complexity region 192 208 N/A INTRINSIC
TBC 279 492 8.68e-56 SMART
Blast:TBC 500 587 5e-35 BLAST
PDB:1BJF|B 579 703 3e-7 PDB
low complexity region 917 937 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093393
AA Change: M1T

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000091093
Gene: ENSMUSG00000031709
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 31 55 N/A INTRINSIC
GRAM 146 213 1.2e-25 SMART
low complexity region 267 278 N/A INTRINSIC
GRAM 293 361 1.37e-20 SMART
low complexity region 425 441 N/A INTRINSIC
TBC 512 725 8.68e-56 SMART
Blast:TBC 733 820 6e-35 BLAST
PDB:1BJF|B 812 936 4e-7 PDB
low complexity region 1150 1170 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098605
AA Change: M1V
SMART Domains Protein: ENSMUSP00000096205
Gene: ENSMUSG00000074228
AA Change: M1V

DomainStartEndE-ValueType
low complexity region 69 85 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,328,632 V256A probably benign Het
Acap1 T C 11: 69,889,491 N42S possibly damaging Het
Apoo-ps C A 13: 107,414,640 noncoding transcript Het
Bri3 C T 5: 144,244,601 T39I probably benign Het
Bsn A G 9: 108,106,920 S3312P unknown Het
Camkmt C A 17: 85,090,775 A17E possibly damaging Het
Cc2d2a G T 5: 43,671,305 probably null Het
Ccdc122 G T 14: 77,091,958 M150I possibly damaging Het
Celf4 A G 18: 25,753,459 F57L probably damaging Het
Cep192 T A 18: 67,824,688 F564Y possibly damaging Het
Ces1c T C 8: 93,123,212 D38G probably damaging Het
Cts7 C A 13: 61,355,617 G178* probably null Het
Dcc A T 18: 71,456,883 Y681N probably damaging Het
Dhx29 A G 13: 112,946,974 E521G possibly damaging Het
Dnase2a T C 8: 84,908,993 V35A probably damaging Het
Eif3l A G 15: 79,085,607 M268V probably damaging Het
Foxc1 A G 13: 31,808,798 M531V unknown Het
Grin2c A G 11: 115,251,134 Y820H probably damaging Het
Ifit1bl1 G A 19: 34,594,889 A56V probably benign Het
Iqsec1 T C 6: 90,689,883 E524G possibly damaging Het
Kcnt2 A G 1: 140,376,353 I154V possibly damaging Het
Kdm1b T A 13: 47,062,975 Y274N probably benign Het
Kntc1 T A 5: 123,810,859 L1889Q probably damaging Het
Lama1 A G 17: 67,768,317 T1010A probably benign Het
Mmp11 T C 10: 75,927,245 N171S probably benign Het
Myom1 A G 17: 71,110,735 E1409G probably damaging Het
N4bp1 A G 8: 86,862,040 I90T probably damaging Het
Olfr1263 T C 2: 90,015,341 V137A probably benign Het
Plcb4 T C 2: 135,950,382 S342P probably damaging Het
Plg A G 17: 12,410,960 E627G probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc7a14 A G 3: 31,230,320 I289T probably damaging Het
Srpr G A 9: 35,212,001 G43S possibly damaging Het
Tcte2 A T 17: 13,714,077 I90N possibly damaging Het
Trim30c G A 7: 104,382,274 P445S probably damaging Het
Trrap A G 5: 144,817,966 Q1984R probably damaging Het
Ubn2 T C 6: 38,491,005 S885P probably benign Het
Unc45a A G 7: 80,339,669 F17S probably damaging Het
Uts2b C T 16: 27,361,032 V75I probably benign Het
Vmn2r103 A G 17: 19,773,531 K57E probably benign Het
Vmn2r82 A G 10: 79,385,376 S524G probably damaging Het
Other mutations in Tbc1d9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Tbc1d9 APN 8 83234162 missense probably damaging 1.00
IGL01443:Tbc1d9 APN 8 83239931 missense probably damaging 1.00
IGL01536:Tbc1d9 APN 8 83260992 missense probably damaging 1.00
IGL01811:Tbc1d9 APN 8 83233678 missense probably damaging 1.00
IGL02068:Tbc1d9 APN 8 83239868 missense probably damaging 1.00
IGL02938:Tbc1d9 APN 8 83269067 splice site probably benign
IGL02995:Tbc1d9 APN 8 83269059 critical splice donor site probably null
IGL03127:Tbc1d9 APN 8 83249473 missense probably damaging 1.00
IGL03128:Tbc1d9 APN 8 83166085 missense probably benign 0.01
H9600:Tbc1d9 UTSW 8 83210461 missense probably damaging 1.00
R0067:Tbc1d9 UTSW 8 83234243 missense probably damaging 1.00
R0067:Tbc1d9 UTSW 8 83234243 missense probably damaging 1.00
R0112:Tbc1d9 UTSW 8 83264837 splice site probably benign
R0525:Tbc1d9 UTSW 8 83268985 missense probably benign 0.08
R0528:Tbc1d9 UTSW 8 83210456 missense probably damaging 1.00
R0737:Tbc1d9 UTSW 8 83259313 missense probably damaging 1.00
R1144:Tbc1d9 UTSW 8 83236571 missense possibly damaging 0.93
R1354:Tbc1d9 UTSW 8 83268981 critical splice acceptor site probably null
R1551:Tbc1d9 UTSW 8 83266158 missense probably benign 0.03
R1620:Tbc1d9 UTSW 8 83249595 missense probably damaging 1.00
R1971:Tbc1d9 UTSW 8 83249510 missense probably damaging 1.00
R1990:Tbc1d9 UTSW 8 83271303 missense probably damaging 1.00
R2082:Tbc1d9 UTSW 8 83270987 missense probably damaging 1.00
R2149:Tbc1d9 UTSW 8 83271449 missense probably damaging 1.00
R2920:Tbc1d9 UTSW 8 83210469 missense probably benign 0.00
R3832:Tbc1d9 UTSW 8 83233663 missense probably damaging 1.00
R3953:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R3955:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R3956:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R3957:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R4117:Tbc1d9 UTSW 8 83266147 missense possibly damaging 0.93
R4467:Tbc1d9 UTSW 8 83210478 missense probably damaging 1.00
R4533:Tbc1d9 UTSW 8 83270918 missense probably damaging 1.00
R4568:Tbc1d9 UTSW 8 83271177 missense probably benign 0.00
R4694:Tbc1d9 UTSW 8 83234246 missense probably damaging 1.00
R4804:Tbc1d9 UTSW 8 83255925 critical splice donor site probably null
R5056:Tbc1d9 UTSW 8 83269206 missense probably benign
R5073:Tbc1d9 UTSW 8 83233547 missense probably damaging 1.00
R5122:Tbc1d9 UTSW 8 83236543 missense probably damaging 0.98
R5270:Tbc1d9 UTSW 8 83233654 missense probably benign
R5618:Tbc1d9 UTSW 8 83242592 missense probably damaging 1.00
R5738:Tbc1d9 UTSW 8 83271026 missense probably benign
R5793:Tbc1d9 UTSW 8 83271440 missense probably damaging 0.96
R5908:Tbc1d9 UTSW 8 83249545 missense probably benign 0.05
R6258:Tbc1d9 UTSW 8 83210516 missense probably damaging 1.00
R6584:Tbc1d9 UTSW 8 83261000 missense probably damaging 0.98
R6888:Tbc1d9 UTSW 8 83271588 missense possibly damaging 0.92
R6897:Tbc1d9 UTSW 8 83166180 missense probably damaging 1.00
R6969:Tbc1d9 UTSW 8 83241542 missense probably damaging 0.99
R7026:Tbc1d9 UTSW 8 83241563 missense probably benign 0.06
R7072:Tbc1d9 UTSW 8 83264865 missense probably damaging 0.97
R7099:Tbc1d9 UTSW 8 83254891 missense probably damaging 1.00
R7138:Tbc1d9 UTSW 8 83210484 missense probably damaging 1.00
R7172:Tbc1d9 UTSW 8 83254761 missense probably damaging 0.96
R7267:Tbc1d9 UTSW 8 83271328 missense probably damaging 1.00
R7371:Tbc1d9 UTSW 8 83271261 missense probably damaging 0.96
R7457:Tbc1d9 UTSW 8 83236680 missense probably damaging 0.99
R7552:Tbc1d9 UTSW 8 83239931 missense probably damaging 1.00
R7645:Tbc1d9 UTSW 8 83242553 missense probably damaging 1.00
R7728:Tbc1d9 UTSW 8 83259350 missense probably damaging 0.99
X0062:Tbc1d9 UTSW 8 83233702 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGGGAGGATGCTACTTGCTG -3'
(R):5'- AGGCGTTTCTCTCCTAGTCTGG -3'

Sequencing Primer
(F):5'- GATGCTACTTGCTGGGTCCC -3'
(R):5'- CTCCTAGTCTGGGGGAAAATAAAATC -3'
Posted On2014-11-12