Incidental Mutation 'R2442:Grin2c'
ID249829
Institutional Source Beutler Lab
Gene Symbol Grin2c
Ensembl Gene ENSMUSG00000020734
Gene Nameglutamate receptor, ionotropic, NMDA2C (epsilon 3)
SynonymsNR2C, GluRepsilon3, NMDAR2C
MMRRC Submission 040400-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R2442 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location115249169-115267243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115251134 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 820 (Y820H)
Ref Sequence ENSEMBL: ENSMUSP00000102164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003351] [ENSMUST00000061450] [ENSMUST00000100235] [ENSMUST00000106554]
Predicted Effect probably damaging
Transcript: ENSMUST00000003351
AA Change: Y820H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003351
Gene: ENSMUSG00000020734
AA Change: Y820H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 99 299 5.1e-12 PFAM
PBPe 440 796 1.11e-79 SMART
Lig_chan-Glu_bd 448 500 2.79e-18 SMART
transmembrane domain 816 835 N/A INTRINSIC
Pfam:NMDAR2_C 837 924 6.8e-15 PFAM
low complexity region 941 975 N/A INTRINSIC
low complexity region 1041 1058 N/A INTRINSIC
low complexity region 1063 1076 N/A INTRINSIC
low complexity region 1173 1182 N/A INTRINSIC
low complexity region 1194 1203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061450
SMART Domains Protein: ENSMUSP00000056805
Gene: ENSMUSG00000045980

DomainStartEndE-ValueType
Pfam:Aa_trans 13 77 3.4e-10 PFAM
low complexity region 84 100 N/A INTRINSIC
Pfam:Aa_trans 128 487 4.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100235
SMART Domains Protein: ENSMUSP00000097807
Gene: ENSMUSG00000045980

DomainStartEndE-ValueType
Pfam:Aa_trans 13 81 5.5e-11 PFAM
low complexity region 84 100 N/A INTRINSIC
Pfam:Aa_trans 127 485 1.2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106554
AA Change: Y820H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102164
Gene: ENSMUSG00000020734
AA Change: Y820H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 100 306 6.9e-10 PFAM
PBPe 440 796 1.11e-79 SMART
Lig_chan-Glu_bd 448 500 2.79e-18 SMART
transmembrane domain 816 835 N/A INTRINSIC
Pfam:NMDAR2_C 837 926 1.1e-13 PFAM
low complexity region 941 975 N/A INTRINSIC
low complexity region 1041 1058 N/A INTRINSIC
low complexity region 1063 1076 N/A INTRINSIC
low complexity region 1173 1182 N/A INTRINSIC
low complexity region 1194 1203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158919
Meta Mutation Damage Score 0.8718 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptor, which is a subtype of ionotropic glutamate receptor. NMDA receptors are found in the central nervous system, are permeable to cations and have an important role in physiological processes such as learning, memory, and synaptic development. The receptor is a tetramer of different subunits (typically heterodimer of subunit 1 with one or more of subunits 2A-D), forming a channel that is permeable to calcium, potassium, and sodium, and whose properties are determined by subunit composition. Alterations in the subunit composition of the receptor are associated with pathophysiological conditions such as Parkinson's disease, Alzheimer's disease, depression, and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit deficits in motor coordination and reduced granule cell responses to N-methy-D-aspartate in brain slices. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,328,632 V256A probably benign Het
Acap1 T C 11: 69,889,491 N42S possibly damaging Het
Apoo-ps C A 13: 107,414,640 noncoding transcript Het
Bri3 C T 5: 144,244,601 T39I probably benign Het
Bsn A G 9: 108,106,920 S3312P unknown Het
Camkmt C A 17: 85,090,775 A17E possibly damaging Het
Cc2d2a G T 5: 43,671,305 probably null Het
Ccdc122 G T 14: 77,091,958 M150I possibly damaging Het
Celf4 A G 18: 25,753,459 F57L probably damaging Het
Cep192 T A 18: 67,824,688 F564Y possibly damaging Het
Ces1c T C 8: 93,123,212 D38G probably damaging Het
Cts7 C A 13: 61,355,617 G178* probably null Het
Dcc A T 18: 71,456,883 Y681N probably damaging Het
Dhx29 A G 13: 112,946,974 E521G possibly damaging Het
Dnase2a T C 8: 84,908,993 V35A probably damaging Het
Eif3l A G 15: 79,085,607 M268V probably damaging Het
Foxc1 A G 13: 31,808,798 M531V unknown Het
Ifit1bl1 G A 19: 34,594,889 A56V probably benign Het
Iqsec1 T C 6: 90,689,883 E524G possibly damaging Het
Kcnt2 A G 1: 140,376,353 I154V possibly damaging Het
Kdm1b T A 13: 47,062,975 Y274N probably benign Het
Kntc1 T A 5: 123,810,859 L1889Q probably damaging Het
Lama1 A G 17: 67,768,317 T1010A probably benign Het
Mmp11 T C 10: 75,927,245 N171S probably benign Het
Myom1 A G 17: 71,110,735 E1409G probably damaging Het
N4bp1 A G 8: 86,862,040 I90T probably damaging Het
Olfr1263 T C 2: 90,015,341 V137A probably benign Het
Plcb4 T C 2: 135,950,382 S342P probably damaging Het
Plg A G 17: 12,410,960 E627G probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc7a14 A G 3: 31,230,320 I289T probably damaging Het
Srpr G A 9: 35,212,001 G43S possibly damaging Het
Tbc1d9 T C 8: 83,166,076 M1T probably null Het
Tcte2 A T 17: 13,714,077 I90N possibly damaging Het
Trim30c G A 7: 104,382,274 P445S probably damaging Het
Trrap A G 5: 144,817,966 Q1984R probably damaging Het
Ubn2 T C 6: 38,491,005 S885P probably benign Het
Unc45a A G 7: 80,339,669 F17S probably damaging Het
Uts2b C T 16: 27,361,032 V75I probably benign Het
Vmn2r103 A G 17: 19,773,531 K57E probably benign Het
Vmn2r82 A G 10: 79,385,376 S524G probably damaging Het
Other mutations in Grin2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Grin2c APN 11 115258110 missense possibly damaging 0.94
IGL01306:Grin2c APN 11 115256194 missense probably benign 0.01
IGL01408:Grin2c APN 11 115260882 missense probably damaging 1.00
IGL01539:Grin2c APN 11 115250106 missense probably benign 0.32
IGL01931:Grin2c APN 11 115253910 missense probably damaging 1.00
IGL01964:Grin2c APN 11 115253847 missense probably damaging 1.00
IGL02796:Grin2c APN 11 115250717 splice site probably benign
IGL02956:Grin2c APN 11 115257959 missense possibly damaging 0.86
IGL03221:Grin2c APN 11 115254044 splice site probably benign
ANU23:Grin2c UTSW 11 115256194 missense probably benign 0.01
BB007:Grin2c UTSW 11 115256237 missense probably benign 0.01
BB017:Grin2c UTSW 11 115256237 missense probably benign 0.01
PIT4362001:Grin2c UTSW 11 115249633 missense probably benign
R0011:Grin2c UTSW 11 115255750 missense probably damaging 1.00
R0011:Grin2c UTSW 11 115255750 missense probably damaging 1.00
R0112:Grin2c UTSW 11 115251134 missense probably damaging 1.00
R0355:Grin2c UTSW 11 115260728 splice site probably benign
R0681:Grin2c UTSW 11 115249653 missense probably benign
R0791:Grin2c UTSW 11 115250646 missense probably damaging 1.00
R0792:Grin2c UTSW 11 115250646 missense probably damaging 1.00
R1512:Grin2c UTSW 11 115253850 missense probably damaging 1.00
R1572:Grin2c UTSW 11 115256074 missense possibly damaging 0.92
R1654:Grin2c UTSW 11 115260853 missense probably benign 0.21
R1803:Grin2c UTSW 11 115260732 critical splice donor site probably null
R1982:Grin2c UTSW 11 115260905 missense possibly damaging 0.96
R2050:Grin2c UTSW 11 115257419 missense possibly damaging 0.89
R2196:Grin2c UTSW 11 115250666 missense probably benign 0.34
R2509:Grin2c UTSW 11 115251068 nonsense probably null
R3440:Grin2c UTSW 11 115250643 missense probably damaging 1.00
R3965:Grin2c UTSW 11 115260994 missense probably damaging 1.00
R4618:Grin2c UTSW 11 115252747 missense probably damaging 1.00
R4735:Grin2c UTSW 11 115249596 missense possibly damaging 0.63
R4856:Grin2c UTSW 11 115260790 missense probably damaging 1.00
R4886:Grin2c UTSW 11 115260790 missense probably damaging 1.00
R5277:Grin2c UTSW 11 115253813 missense probably damaging 1.00
R5334:Grin2c UTSW 11 115256055 missense possibly damaging 0.76
R5553:Grin2c UTSW 11 115252725 missense probably null 0.96
R5711:Grin2c UTSW 11 115250289 missense probably benign 0.32
R5784:Grin2c UTSW 11 115258295 missense possibly damaging 0.94
R5849:Grin2c UTSW 11 115260991 missense probably benign
R6421:Grin2c UTSW 11 115251130 missense probably damaging 1.00
R6461:Grin2c UTSW 11 115255696 missense possibly damaging 0.96
R6658:Grin2c UTSW 11 115258282 missense possibly damaging 0.64
R7205:Grin2c UTSW 11 115251050 missense probably damaging 0.99
R7611:Grin2c UTSW 11 115252685 missense probably damaging 1.00
R7637:Grin2c UTSW 11 115256259 splice site probably null
R7751:Grin2c UTSW 11 115253870 missense probably damaging 1.00
R7847:Grin2c UTSW 11 115260978 missense possibly damaging 0.68
R7920:Grin2c UTSW 11 115254144 missense probably benign 0.33
R7930:Grin2c UTSW 11 115256237 missense probably benign 0.01
R7940:Grin2c UTSW 11 115255281 missense probably damaging 1.00
R7956:Grin2c UTSW 11 115250148 missense probably benign 0.16
R8081:Grin2c UTSW 11 115249893 missense probably damaging 0.98
R8249:Grin2c UTSW 11 115253837 missense probably damaging 0.98
R8447:Grin2c UTSW 11 115257389 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAAATGGGTCTACCGCCAGC -3'
(R):5'- GAAACAAGGATGCCTAACTGTC -3'

Sequencing Primer
(F):5'- AGCTAGGTTGCTGTGCCTAAC -3'
(R):5'- ACAAGGATGCCTAACTGTCCTCTATC -3'
Posted On2014-11-12