Incidental Mutation 'R0308:Cfap54'
ID 24983
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Name cilia and flagella associated protein 54
Synonyms LOC380653, Gm872, 4930485B16Rik
MMRRC Submission 038518-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R0308 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 92611481-92917480 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 92721226 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 2502 (D2502Y)
Ref Sequence ENSEMBL: ENSMUSP00000148636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000212902]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000168110
AA Change: D2437Y
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: D2437Y

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000212902
AA Change: D2502Y
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (82/82)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,989 (GRCm39) D65V probably damaging Het
4933407L21Rik A T 1: 85,859,007 (GRCm39) probably benign Het
Abcc12 C T 8: 87,284,381 (GRCm39) probably benign Het
Adamts12 A G 15: 11,311,646 (GRCm39) E1301G probably damaging Het
Adh4 A T 3: 138,129,863 (GRCm39) N230Y probably damaging Het
Anapc15-ps T A 10: 95,508,954 (GRCm39) M109L probably benign Het
Angpt2 T C 8: 18,742,141 (GRCm39) I472V possibly damaging Het
Arhgef26 C A 3: 62,247,820 (GRCm39) D301E probably benign Het
Armc10 G A 5: 21,852,295 (GRCm39) probably benign Het
Atm T C 9: 53,365,773 (GRCm39) probably null Het
Atp5f1b T C 10: 127,921,908 (GRCm39) V265A probably benign Het
Atp8b1 G T 18: 64,678,315 (GRCm39) C860* probably null Het
Atrnl1 T G 19: 57,741,720 (GRCm39) S1160A probably benign Het
Bmal1 A T 7: 112,890,743 (GRCm39) I179F probably damaging Het
Cep55 A G 19: 38,048,659 (GRCm39) E105G possibly damaging Het
Cilp2 A G 8: 70,335,643 (GRCm39) S452P probably benign Het
Clptm1l A G 13: 73,759,786 (GRCm39) D282G possibly damaging Het
Csrp1 C A 1: 135,673,024 (GRCm39) T47N probably damaging Het
Cyp2c40 T A 19: 39,766,432 (GRCm39) I388F probably damaging Het
Dars1 C T 1: 128,291,996 (GRCm39) R494H probably damaging Het
Dna2 T C 10: 62,792,753 (GRCm39) V256A probably damaging Het
Dock7 T C 4: 98,873,051 (GRCm39) T1132A probably benign Het
Dpcd T G 19: 45,565,445 (GRCm39) F140V probably damaging Het
Elk3 A T 10: 93,101,067 (GRCm39) M228K probably benign Het
Erich6 A G 3: 58,543,525 (GRCm39) F182L probably damaging Het
Fhad1 A G 4: 141,712,904 (GRCm39) probably benign Het
Fryl A T 5: 73,198,947 (GRCm39) probably benign Het
Fzd9 A T 5: 135,278,260 (GRCm39) C542S probably damaging Het
Gba1 A G 3: 89,115,671 (GRCm39) T460A probably benign Het
Gli2 C T 1: 118,769,792 (GRCm39) A587T probably benign Het
Gm11011 C T 2: 169,424,614 (GRCm39) probably benign Het
Gmppb A G 9: 107,927,033 (GRCm39) E68G probably benign Het
Gpld1 A G 13: 25,146,818 (GRCm39) N260S possibly damaging Het
Hipk3 G A 2: 104,263,552 (GRCm39) S900L probably damaging Het
Idi2l T G 13: 8,990,877 (GRCm39) probably benign Het
Ints6l A T X: 55,526,715 (GRCm39) M215L possibly damaging Het
Irx6 T A 8: 93,403,659 (GRCm39) L128Q probably damaging Het
Itga10 T C 3: 96,558,780 (GRCm39) S373P probably damaging Het
Jak1 T C 4: 101,011,732 (GRCm39) probably null Het
Jak2 C T 19: 29,289,157 (GRCm39) T1103I probably benign Het
Katnal1 A T 5: 148,815,734 (GRCm39) V401D possibly damaging Het
Krbox5 A G 13: 67,991,232 (GRCm39) probably benign Het
Lrp2 T A 2: 69,313,326 (GRCm39) probably benign Het
Map3k13 A G 16: 21,710,738 (GRCm39) H7R probably benign Het
Mrgprx3-ps A G 7: 46,959,766 (GRCm39) V75A probably benign Het
Nol6 C T 4: 41,123,584 (GRCm39) A55T probably benign Het
Opa1 G A 16: 29,440,349 (GRCm39) R818Q probably damaging Het
Opn4 T C 14: 34,319,081 (GRCm39) Y168C possibly damaging Het
Or8b35 A G 9: 37,904,141 (GRCm39) I118V probably benign Het
Phf21a T C 2: 92,161,122 (GRCm39) V330A possibly damaging Het
Phykpl A G 11: 51,484,423 (GRCm39) probably benign Het
Plcb1 T G 2: 134,655,534 (GRCm39) V38G probably benign Het
Plxna4 T A 6: 32,214,703 (GRCm39) T593S probably benign Het
Poll A T 19: 45,544,404 (GRCm39) I339N probably damaging Het
Rev3l A G 10: 39,700,890 (GRCm39) I1796V probably benign Het
Rnf103 G A 6: 71,486,686 (GRCm39) R439H probably damaging Het
Rrn3 G A 16: 13,617,746 (GRCm39) probably benign Het
Sec14l4 G A 11: 3,991,726 (GRCm39) probably benign Het
Sec23a A C 12: 59,053,985 (GRCm39) Y4* probably null Het
Senp6 T C 9: 80,040,265 (GRCm39) probably null Het
Serpinb6b A T 13: 33,162,220 (GRCm39) N221Y probably benign Het
Slc6a2 A G 8: 93,687,988 (GRCm39) E38G possibly damaging Het
Smap1 A T 1: 23,888,423 (GRCm39) L196I probably damaging Het
Sorbs2 C T 8: 46,248,167 (GRCm39) Q473* probably null Het
Sphkap C A 1: 83,254,690 (GRCm39) V1020F probably damaging Het
Srfbp1 T C 18: 52,621,614 (GRCm39) V225A probably benign Het
Srprb G A 9: 103,079,204 (GRCm39) P728S possibly damaging Het
Tarm1 T C 7: 3,545,187 (GRCm39) probably benign Het
Tcp1 T A 17: 13,139,306 (GRCm39) I162N probably benign Het
Tmem237 C A 1: 59,146,676 (GRCm39) A292S probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Tnpo1 A G 13: 98,983,011 (GRCm39) F884L probably damaging Het
Trim7 A G 11: 48,740,328 (GRCm39) T142A probably damaging Het
Ttn T A 2: 76,616,024 (GRCm39) I14894F probably damaging Het
Tubgcp6 T C 15: 89,006,639 (GRCm39) R128G possibly damaging Het
Ube2d2b A G 5: 107,978,774 (GRCm39) T142A possibly damaging Het
Unc13c G T 9: 73,388,400 (GRCm39) L2129I probably benign Het
Ushbp1 T C 8: 71,843,697 (GRCm39) D247G probably damaging Het
Usp43 G A 11: 67,770,966 (GRCm39) A556V probably damaging Het
Zfp438 T A 18: 5,213,638 (GRCm39) H440L probably benign Het
Zfp518b C T 5: 38,830,113 (GRCm39) E631K possibly damaging Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 92,917,385 (GRCm39) missense unknown
IGL02034:Cfap54 APN 10 92,897,347 (GRCm39) missense probably damaging 0.99
IGL02082:Cfap54 APN 10 92,917,320 (GRCm39) missense unknown
IGL02434:Cfap54 APN 10 92,902,616 (GRCm39) missense probably benign 0.20
R0011:Cfap54 UTSW 10 92,901,087 (GRCm39) missense probably damaging 0.97
R0011:Cfap54 UTSW 10 92,901,087 (GRCm39) missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92,768,559 (GRCm39) missense probably benign 0.04
R0032:Cfap54 UTSW 10 92,768,559 (GRCm39) missense probably benign 0.04
R0040:Cfap54 UTSW 10 92,812,901 (GRCm39) missense probably benign 0.33
R0044:Cfap54 UTSW 10 92,871,295 (GRCm39) missense probably null 0.46
R0086:Cfap54 UTSW 10 92,864,456 (GRCm39) missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 92,864,514 (GRCm39) missense probably damaging 1.00
R0194:Cfap54 UTSW 10 92,870,524 (GRCm39) unclassified probably benign
R0234:Cfap54 UTSW 10 92,735,022 (GRCm39) nonsense probably null
R0332:Cfap54 UTSW 10 92,871,319 (GRCm39) missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92,612,075 (GRCm39) missense probably benign 0.00
R0433:Cfap54 UTSW 10 92,814,942 (GRCm39) splice site probably benign
R0436:Cfap54 UTSW 10 92,874,837 (GRCm39) missense possibly damaging 0.95
R0463:Cfap54 UTSW 10 92,710,805 (GRCm39) critical splice donor site probably null
R0523:Cfap54 UTSW 10 92,744,745 (GRCm39) utr 3 prime probably benign
R0551:Cfap54 UTSW 10 92,860,984 (GRCm39) missense probably benign 0.35
R0595:Cfap54 UTSW 10 92,720,598 (GRCm39) missense unknown
R0617:Cfap54 UTSW 10 92,665,512 (GRCm39) splice site probably benign
R0632:Cfap54 UTSW 10 92,720,958 (GRCm39) missense unknown
R0730:Cfap54 UTSW 10 92,870,599 (GRCm39) missense probably benign 0.05
R0786:Cfap54 UTSW 10 92,803,397 (GRCm39) missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92,706,531 (GRCm39) missense unknown
R1004:Cfap54 UTSW 10 92,902,558 (GRCm39) splice site probably benign
R1033:Cfap54 UTSW 10 92,675,311 (GRCm39) missense probably benign 0.07
R1168:Cfap54 UTSW 10 92,773,782 (GRCm39) missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92,711,856 (GRCm39) missense unknown
R1429:Cfap54 UTSW 10 92,656,900 (GRCm39) missense probably benign 0.01
R1443:Cfap54 UTSW 10 92,768,583 (GRCm39) missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92,805,625 (GRCm39) missense probably benign 0.01
R1467:Cfap54 UTSW 10 92,805,625 (GRCm39) missense probably benign 0.01
R1557:Cfap54 UTSW 10 92,820,089 (GRCm39) missense possibly damaging 0.68
R1687:Cfap54 UTSW 10 92,768,502 (GRCm39) missense probably damaging 1.00
R1690:Cfap54 UTSW 10 92,871,304 (GRCm39) missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 92,846,882 (GRCm39) missense probably damaging 1.00
R1756:Cfap54 UTSW 10 92,883,923 (GRCm39) missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92,740,125 (GRCm39) critical splice donor site probably null
R1835:Cfap54 UTSW 10 92,798,237 (GRCm39) missense probably benign 0.35
R1889:Cfap54 UTSW 10 92,870,572 (GRCm39) missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92,720,564 (GRCm39) missense unknown
R1958:Cfap54 UTSW 10 92,833,204 (GRCm39) missense probably benign 0.18
R2005:Cfap54 UTSW 10 92,720,630 (GRCm39) missense unknown
R2018:Cfap54 UTSW 10 92,852,466 (GRCm39) missense probably benign 0.00
R2045:Cfap54 UTSW 10 92,874,671 (GRCm39) splice site probably null
R2059:Cfap54 UTSW 10 92,778,841 (GRCm39) unclassified probably benign
R2100:Cfap54 UTSW 10 92,837,799 (GRCm39) missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92,722,229 (GRCm39) missense unknown
R2392:Cfap54 UTSW 10 92,860,873 (GRCm39) critical splice donor site probably null
R2508:Cfap54 UTSW 10 92,833,236 (GRCm39) missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92,776,017 (GRCm39) missense probably damaging 1.00
R2857:Cfap54 UTSW 10 92,881,144 (GRCm39) missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92,757,281 (GRCm39) missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92,757,281 (GRCm39) missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92,830,545 (GRCm39) missense probably benign 0.04
R3108:Cfap54 UTSW 10 92,830,545 (GRCm39) missense probably benign 0.04
R3157:Cfap54 UTSW 10 92,834,918 (GRCm39) missense probably benign 0.03
R3158:Cfap54 UTSW 10 92,834,918 (GRCm39) missense probably benign 0.03
R3159:Cfap54 UTSW 10 92,834,918 (GRCm39) missense probably benign 0.03
R3161:Cfap54 UTSW 10 92,881,140 (GRCm39) missense probably damaging 1.00
R3162:Cfap54 UTSW 10 92,881,140 (GRCm39) missense probably damaging 1.00
R3162:Cfap54 UTSW 10 92,881,140 (GRCm39) missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92,721,286 (GRCm39) missense unknown
R3730:Cfap54 UTSW 10 92,847,335 (GRCm39) nonsense probably null
R3770:Cfap54 UTSW 10 92,714,398 (GRCm39) missense unknown
R3776:Cfap54 UTSW 10 92,880,962 (GRCm39) missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92,740,206 (GRCm39) utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92,778,735 (GRCm39) unclassified probably benign
R3834:Cfap54 UTSW 10 92,636,985 (GRCm39) splice site probably benign
R3891:Cfap54 UTSW 10 92,874,708 (GRCm39) missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92,665,619 (GRCm39) missense probably benign 0.03
R3973:Cfap54 UTSW 10 92,675,333 (GRCm39) missense possibly damaging 0.95
R3974:Cfap54 UTSW 10 92,675,333 (GRCm39) missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92,675,333 (GRCm39) missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92,798,274 (GRCm39) missense probably benign 0.01
R4190:Cfap54 UTSW 10 92,720,885 (GRCm39) missense unknown
R4389:Cfap54 UTSW 10 92,803,362 (GRCm39) missense probably benign 0.37
R4542:Cfap54 UTSW 10 92,860,991 (GRCm39) missense probably benign 0.12
R4564:Cfap54 UTSW 10 92,675,402 (GRCm39) unclassified probably benign
R4576:Cfap54 UTSW 10 92,879,090 (GRCm39) critical splice donor site probably null
R4620:Cfap54 UTSW 10 92,805,619 (GRCm39) missense probably benign 0.01
R4714:Cfap54 UTSW 10 92,651,780 (GRCm39) missense probably benign 0.01
R4762:Cfap54 UTSW 10 92,897,315 (GRCm39) splice site probably null
R4776:Cfap54 UTSW 10 92,808,556 (GRCm39) missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92,672,339 (GRCm39) nonsense probably null
R4827:Cfap54 UTSW 10 92,737,937 (GRCm39) utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92,803,390 (GRCm39) missense probably benign 0.01
R4965:Cfap54 UTSW 10 92,902,661 (GRCm39) missense probably benign 0.23
R5001:Cfap54 UTSW 10 92,800,396 (GRCm39) missense probably benign 0.01
R5060:Cfap54 UTSW 10 92,875,013 (GRCm39) missense probably damaging 1.00
R5067:Cfap54 UTSW 10 92,902,628 (GRCm39) missense probably benign 0.17
R5069:Cfap54 UTSW 10 92,773,636 (GRCm39) missense probably benign
R5094:Cfap54 UTSW 10 92,734,861 (GRCm39) utr 3 prime probably benign
R5109:Cfap54 UTSW 10 92,773,753 (GRCm39) missense probably benign 0.03
R5127:Cfap54 UTSW 10 92,722,249 (GRCm39) splice site probably null
R5143:Cfap54 UTSW 10 92,865,020 (GRCm39) missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92,773,700 (GRCm39) missense probably benign 0.00
R5158:Cfap54 UTSW 10 92,901,059 (GRCm39) missense probably damaging 1.00
R5256:Cfap54 UTSW 10 92,880,885 (GRCm39) splice site probably null
R5256:Cfap54 UTSW 10 92,770,953 (GRCm39) nonsense probably null
R5266:Cfap54 UTSW 10 92,651,764 (GRCm39) missense probably benign 0.16
R5304:Cfap54 UTSW 10 92,656,968 (GRCm39) missense probably damaging 0.97
R5369:Cfap54 UTSW 10 92,897,119 (GRCm39) intron probably benign
R5406:Cfap54 UTSW 10 92,837,720 (GRCm39) missense probably benign 0.33
R5471:Cfap54 UTSW 10 92,864,522 (GRCm39) missense probably damaging 1.00
R5485:Cfap54 UTSW 10 92,864,979 (GRCm39) missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92,808,470 (GRCm39) missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92,808,473 (GRCm39) nonsense probably null
R5614:Cfap54 UTSW 10 92,880,911 (GRCm39) missense probably damaging 1.00
R5634:Cfap54 UTSW 10 92,740,125 (GRCm39) critical splice donor site probably benign
R5680:Cfap54 UTSW 10 92,814,879 (GRCm39) nonsense probably null
R5797:Cfap54 UTSW 10 92,803,438 (GRCm39) missense probably benign 0.11
R5859:Cfap54 UTSW 10 92,852,386 (GRCm39) nonsense probably null
R5878:Cfap54 UTSW 10 92,800,423 (GRCm39) missense probably benign 0.01
R5910:Cfap54 UTSW 10 92,901,043 (GRCm39) missense probably damaging 0.99
R5936:Cfap54 UTSW 10 92,798,274 (GRCm39) missense probably benign 0.01
R5994:Cfap54 UTSW 10 92,874,943 (GRCm39) missense probably damaging 0.99
R6080:Cfap54 UTSW 10 92,881,197 (GRCm39) missense possibly damaging 0.64
R6268:Cfap54 UTSW 10 92,874,771 (GRCm39) missense probably damaging 1.00
R6296:Cfap54 UTSW 10 92,902,708 (GRCm39) missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92,803,354 (GRCm39) missense probably benign 0.04
R6545:Cfap54 UTSW 10 92,672,319 (GRCm39) missense probably benign 0.31
R6570:Cfap54 UTSW 10 92,651,820 (GRCm39) missense unknown
R6597:Cfap54 UTSW 10 92,834,902 (GRCm39) missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92,704,596 (GRCm39) missense unknown
R6703:Cfap54 UTSW 10 92,704,596 (GRCm39) missense unknown
R6720:Cfap54 UTSW 10 92,656,981 (GRCm39) missense probably benign 0.07
R6841:Cfap54 UTSW 10 92,710,877 (GRCm39) missense unknown
R6910:Cfap54 UTSW 10 92,672,374 (GRCm39) missense probably benign 0.29
R6953:Cfap54 UTSW 10 92,830,540 (GRCm39) missense probably benign 0.19
R7009:Cfap54 UTSW 10 92,710,881 (GRCm39) missense unknown
R7129:Cfap54 UTSW 10 92,852,433 (GRCm39) missense probably benign 0.06
R7131:Cfap54 UTSW 10 92,656,966 (GRCm39) missense probably benign 0.03
R7171:Cfap54 UTSW 10 92,612,072 (GRCm39) missense probably damaging 0.99
R7189:Cfap54 UTSW 10 92,773,590 (GRCm39) missense unknown
R7225:Cfap54 UTSW 10 92,740,236 (GRCm39) missense unknown
R7270:Cfap54 UTSW 10 92,675,320 (GRCm39) missense probably benign 0.03
R7323:Cfap54 UTSW 10 92,637,000 (GRCm39) missense probably benign 0.00
R7380:Cfap54 UTSW 10 92,883,840 (GRCm39) missense probably damaging 1.00
R7395:Cfap54 UTSW 10 92,720,565 (GRCm39) missense unknown
R7411:Cfap54 UTSW 10 92,704,617 (GRCm39) missense unknown
R7503:Cfap54 UTSW 10 92,723,298 (GRCm39) splice site probably null
R7622:Cfap54 UTSW 10 92,792,806 (GRCm39) missense unknown
R7679:Cfap54 UTSW 10 92,803,374 (GRCm39) missense probably benign 0.01
R7776:Cfap54 UTSW 10 92,704,603 (GRCm39) missense unknown
R7844:Cfap54 UTSW 10 92,737,920 (GRCm39) missense unknown
R7980:Cfap54 UTSW 10 92,817,922 (GRCm39) missense possibly damaging 0.95
R7988:Cfap54 UTSW 10 92,737,941 (GRCm39) missense unknown
R8101:Cfap54 UTSW 10 92,720,658 (GRCm39) missense unknown
R8119:Cfap54 UTSW 10 92,704,672 (GRCm39) missense unknown
R8134:Cfap54 UTSW 10 92,714,378 (GRCm39) missense unknown
R8168:Cfap54 UTSW 10 92,744,739 (GRCm39) missense unknown
R8179:Cfap54 UTSW 10 92,833,178 (GRCm39) missense possibly damaging 0.68
R8392:Cfap54 UTSW 10 92,798,279 (GRCm39) missense unknown
R8436:Cfap54 UTSW 10 92,800,398 (GRCm39) missense unknown
R8505:Cfap54 UTSW 10 92,814,855 (GRCm39) missense probably benign 0.03
R8671:Cfap54 UTSW 10 92,790,934 (GRCm39) missense unknown
R8716:Cfap54 UTSW 10 92,800,494 (GRCm39) missense probably benign 0.00
R8816:Cfap54 UTSW 10 92,714,454 (GRCm39) missense unknown
R8822:Cfap54 UTSW 10 92,875,003 (GRCm39) missense probably benign 0.09
R8827:Cfap54 UTSW 10 92,774,110 (GRCm39) missense unknown
R8920:Cfap54 UTSW 10 92,776,199 (GRCm39) critical splice acceptor site probably null
R8924:Cfap54 UTSW 10 92,837,685 (GRCm39) missense probably damaging 0.99
R8954:Cfap54 UTSW 10 92,879,255 (GRCm39) missense probably damaging 1.00
R8963:Cfap54 UTSW 10 92,864,562 (GRCm39) nonsense probably null
R9010:Cfap54 UTSW 10 92,734,921 (GRCm39) missense unknown
R9017:Cfap54 UTSW 10 92,651,883 (GRCm39) missense probably benign 0.07
R9093:Cfap54 UTSW 10 92,651,770 (GRCm39) missense probably benign 0.03
R9095:Cfap54 UTSW 10 92,846,882 (GRCm39) missense probably damaging 1.00
R9142:Cfap54 UTSW 10 92,820,097 (GRCm39) missense possibly damaging 0.87
R9178:Cfap54 UTSW 10 92,830,579 (GRCm39) missense probably benign 0.10
R9196:Cfap54 UTSW 10 92,873,753 (GRCm39) missense probably benign 0.22
R9203:Cfap54 UTSW 10 92,880,990 (GRCm39) missense probably benign 0.30
R9258:Cfap54 UTSW 10 92,770,960 (GRCm39) missense unknown
R9275:Cfap54 UTSW 10 92,875,048 (GRCm39) missense possibly damaging 0.86
R9287:Cfap54 UTSW 10 92,805,565 (GRCm39) missense possibly damaging 0.50
R9289:Cfap54 UTSW 10 92,656,936 (GRCm39) missense possibly damaging 0.83
R9310:Cfap54 UTSW 10 92,798,177 (GRCm39) missense unknown
R9397:Cfap54 UTSW 10 92,833,147 (GRCm39) missense probably damaging 0.96
R9462:Cfap54 UTSW 10 92,737,920 (GRCm39) missense unknown
R9697:Cfap54 UTSW 10 92,792,851 (GRCm39) missense unknown
R9746:Cfap54 UTSW 10 92,637,081 (GRCm39) missense probably benign 0.03
R9755:Cfap54 UTSW 10 92,757,230 (GRCm39) missense unknown
X0022:Cfap54 UTSW 10 92,768,476 (GRCm39) missense probably damaging 1.00
X0022:Cfap54 UTSW 10 92,714,465 (GRCm39) missense unknown
X0027:Cfap54 UTSW 10 92,837,750 (GRCm39) missense possibly damaging 0.86
X0027:Cfap54 UTSW 10 92,714,400 (GRCm39) missense unknown
Z1177:Cfap54 UTSW 10 92,814,888 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAATTCGCTCCCTTCCAGCAAAC -3'
(R):5'- AGTAGCTCCCACGGTGACTGATAG -3'

Sequencing Primer
(F):5'- GAGAAAAGGACTCTGTGTTTCCC -3'
(R):5'- CAGCAACTCTGTGTTTCATGTAATC -3'
Posted On 2013-04-16