Incidental Mutation 'R2442:Cts7'
ID249832
Institutional Source Beutler Lab
Gene Symbol Cts7
Ensembl Gene ENSMUSG00000021440
Gene Namecathepsin 7
SynonymsEpcs24, Epcs71, CTS1
MMRRC Submission 040400-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R2442 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location61352461-61358197 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 61355617 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 178 (G178*)
Ref Sequence ENSEMBL: ENSMUSP00000153508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021892] [ENSMUST00000224773] [ENSMUST00000224986] [ENSMUST00000225321]
Predicted Effect probably null
Transcript: ENSMUST00000021892
AA Change: G178*
SMART Domains Protein: ENSMUSP00000021892
Gene: ENSMUSG00000021440
AA Change: G178*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Inhibitor_I29 29 88 2.02e-15 SMART
Pept_C1 112 330 6.25e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224773
Predicted Effect probably null
Transcript: ENSMUST00000224986
AA Change: G178*
Predicted Effect probably null
Transcript: ENSMUST00000225321
AA Change: G178*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,328,632 V256A probably benign Het
Acap1 T C 11: 69,889,491 N42S possibly damaging Het
Apoo-ps C A 13: 107,414,640 noncoding transcript Het
Bri3 C T 5: 144,244,601 T39I probably benign Het
Bsn A G 9: 108,106,920 S3312P unknown Het
Camkmt C A 17: 85,090,775 A17E possibly damaging Het
Cc2d2a G T 5: 43,671,305 probably null Het
Ccdc122 G T 14: 77,091,958 M150I possibly damaging Het
Celf4 A G 18: 25,753,459 F57L probably damaging Het
Cep192 T A 18: 67,824,688 F564Y possibly damaging Het
Ces1c T C 8: 93,123,212 D38G probably damaging Het
Dcc A T 18: 71,456,883 Y681N probably damaging Het
Dhx29 A G 13: 112,946,974 E521G possibly damaging Het
Dnase2a T C 8: 84,908,993 V35A probably damaging Het
Eif3l A G 15: 79,085,607 M268V probably damaging Het
Foxc1 A G 13: 31,808,798 M531V unknown Het
Grin2c A G 11: 115,251,134 Y820H probably damaging Het
Ifit1bl1 G A 19: 34,594,889 A56V probably benign Het
Iqsec1 T C 6: 90,689,883 E524G possibly damaging Het
Kcnt2 A G 1: 140,376,353 I154V possibly damaging Het
Kdm1b T A 13: 47,062,975 Y274N probably benign Het
Kntc1 T A 5: 123,810,859 L1889Q probably damaging Het
Lama1 A G 17: 67,768,317 T1010A probably benign Het
Mmp11 T C 10: 75,927,245 N171S probably benign Het
Myom1 A G 17: 71,110,735 E1409G probably damaging Het
N4bp1 A G 8: 86,862,040 I90T probably damaging Het
Olfr1263 T C 2: 90,015,341 V137A probably benign Het
Plcb4 T C 2: 135,950,382 S342P probably damaging Het
Plg A G 17: 12,410,960 E627G probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc7a14 A G 3: 31,230,320 I289T probably damaging Het
Srpr G A 9: 35,212,001 G43S possibly damaging Het
Tbc1d9 T C 8: 83,166,076 M1T probably null Het
Tcte2 A T 17: 13,714,077 I90N possibly damaging Het
Trim30c G A 7: 104,382,274 P445S probably damaging Het
Trrap A G 5: 144,817,966 Q1984R probably damaging Het
Ubn2 T C 6: 38,491,005 S885P probably benign Het
Unc45a A G 7: 80,339,669 F17S probably damaging Het
Uts2b C T 16: 27,361,032 V75I probably benign Het
Vmn2r103 A G 17: 19,773,531 K57E probably benign Het
Vmn2r82 A G 10: 79,385,376 S524G probably damaging Het
Other mutations in Cts7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Cts7 APN 13 61356909 critical splice donor site probably null
IGL01954:Cts7 APN 13 61352823 missense probably benign 0.06
IGL01973:Cts7 APN 13 61355600 missense probably benign 0.02
IGL02098:Cts7 APN 13 61356529 missense probably damaging 1.00
IGL02716:Cts7 APN 13 61356608 missense probably benign 0.01
IGL02903:Cts7 APN 13 61356626 splice site probably benign
IGL03351:Cts7 APN 13 61356603 missense probably damaging 1.00
PIT4305001:Cts7 UTSW 13 61356572 missense probably damaging 1.00
R0691:Cts7 UTSW 13 61355734 missense probably damaging 1.00
R1168:Cts7 UTSW 13 61353817 missense probably damaging 0.99
R1711:Cts7 UTSW 13 61352810 missense probably damaging 1.00
R2352:Cts7 UTSW 13 61352772 nonsense probably null
R3817:Cts7 UTSW 13 61356536 missense probably damaging 0.98
R5513:Cts7 UTSW 13 61355584 missense possibly damaging 0.70
R5870:Cts7 UTSW 13 61355731 missense probably damaging 0.99
R6286:Cts7 UTSW 13 61352770 missense probably damaging 1.00
R6288:Cts7 UTSW 13 61352770 missense probably damaging 1.00
R6479:Cts7 UTSW 13 61355641 missense probably benign 0.00
R6653:Cts7 UTSW 13 61355003 missense probably damaging 1.00
R6721:Cts7 UTSW 13 61356294 missense probably damaging 1.00
R7246:Cts7 UTSW 13 61355580 missense probably damaging 0.99
R7644:Cts7 UTSW 13 61356968 nonsense probably null
R7939:Cts7 UTSW 13 61356550 missense probably damaging 1.00
R8336:Cts7 UTSW 13 61356909 critical splice donor site probably null
Z1177:Cts7 UTSW 13 61355632 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCAATGTGAGCTCTGAATACAGTG -3'
(R):5'- AGGCACCCATCAAATGCTG -3'

Sequencing Primer
(F):5'- TGAGCTCTGAATACAGTGTATTTTTC -3'
(R):5'- GCACCCATCAAATGCTGATAGTTTAC -3'
Posted On2014-11-12