Incidental Mutation 'R2442:Eif3l'
ID249837
Institutional Source Beutler Lab
Gene Symbol Eif3l
Ensembl Gene ENSMUSG00000033047
Gene Nameeukaryotic translation initiation factor 3, subunit L
SynonymsD15N1e, Eif3s6ip, Eif3eip, PAF67, 0610011H21Rik, HSP-66Y
MMRRC Submission 040400-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R2442 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location79075179-79094405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79085607 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 268 (M268V)
Ref Sequence ENSEMBL: ENSMUSP00000038839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040518]
Predicted Effect probably damaging
Transcript: ENSMUST00000040518
AA Change: M268V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038839
Gene: ENSMUSG00000033047
AA Change: M268V

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
Pfam:Paf67 152 550 7e-179 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230032
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,328,632 V256A probably benign Het
Acap1 T C 11: 69,889,491 N42S possibly damaging Het
Apoo-ps C A 13: 107,414,640 noncoding transcript Het
Bri3 C T 5: 144,244,601 T39I probably benign Het
Bsn A G 9: 108,106,920 S3312P unknown Het
Camkmt C A 17: 85,090,775 A17E possibly damaging Het
Cc2d2a G T 5: 43,671,305 probably null Het
Ccdc122 G T 14: 77,091,958 M150I possibly damaging Het
Celf4 A G 18: 25,753,459 F57L probably damaging Het
Cep192 T A 18: 67,824,688 F564Y possibly damaging Het
Ces1c T C 8: 93,123,212 D38G probably damaging Het
Cts7 C A 13: 61,355,617 G178* probably null Het
Dcc A T 18: 71,456,883 Y681N probably damaging Het
Dhx29 A G 13: 112,946,974 E521G possibly damaging Het
Dnase2a T C 8: 84,908,993 V35A probably damaging Het
Foxc1 A G 13: 31,808,798 M531V unknown Het
Grin2c A G 11: 115,251,134 Y820H probably damaging Het
Ifit1bl1 G A 19: 34,594,889 A56V probably benign Het
Iqsec1 T C 6: 90,689,883 E524G possibly damaging Het
Kcnt2 A G 1: 140,376,353 I154V possibly damaging Het
Kdm1b T A 13: 47,062,975 Y274N probably benign Het
Kntc1 T A 5: 123,810,859 L1889Q probably damaging Het
Lama1 A G 17: 67,768,317 T1010A probably benign Het
Mmp11 T C 10: 75,927,245 N171S probably benign Het
Myom1 A G 17: 71,110,735 E1409G probably damaging Het
N4bp1 A G 8: 86,862,040 I90T probably damaging Het
Olfr1263 T C 2: 90,015,341 V137A probably benign Het
Plcb4 T C 2: 135,950,382 S342P probably damaging Het
Plg A G 17: 12,410,960 E627G probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc7a14 A G 3: 31,230,320 I289T probably damaging Het
Srpr G A 9: 35,212,001 G43S possibly damaging Het
Tbc1d9 T C 8: 83,166,076 M1T probably null Het
Tcte2 A T 17: 13,714,077 I90N possibly damaging Het
Trim30c G A 7: 104,382,274 P445S probably damaging Het
Trrap A G 5: 144,817,966 Q1984R probably damaging Het
Ubn2 T C 6: 38,491,005 S885P probably benign Het
Unc45a A G 7: 80,339,669 F17S probably damaging Het
Uts2b C T 16: 27,361,032 V75I probably benign Het
Vmn2r103 A G 17: 19,773,531 K57E probably benign Het
Vmn2r82 A G 10: 79,385,376 S524G probably damaging Het
Other mutations in Eif3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Eif3l APN 15 79076920 missense possibly damaging 0.82
IGL02457:Eif3l APN 15 79078096 missense probably benign 0.01
IGL02658:Eif3l APN 15 79076942 missense probably damaging 1.00
IGL02689:Eif3l APN 15 79086519 missense possibly damaging 0.77
IGL02797:Eif3l APN 15 79075277 missense probably benign 0.00
IGL02824:Eif3l APN 15 79075823 splice site probably null
IGL02957:Eif3l APN 15 79089828 missense probably benign 0.00
IGL03352:Eif3l APN 15 79077051 unclassified probably benign
R0528:Eif3l UTSW 15 79089609 missense probably benign 0.00
R0550:Eif3l UTSW 15 79076867 missense probably damaging 1.00
R0751:Eif3l UTSW 15 79075766 splice site probably null
R1101:Eif3l UTSW 15 79075267 missense probably damaging 1.00
R1184:Eif3l UTSW 15 79075766 splice site probably null
R1585:Eif3l UTSW 15 79084181 missense possibly damaging 0.63
R1895:Eif3l UTSW 15 79089477 missense possibly damaging 0.55
R4865:Eif3l UTSW 15 79081649 nonsense probably null
R5092:Eif3l UTSW 15 79084154 missense probably benign 0.01
R5239:Eif3l UTSW 15 79089795 missense possibly damaging 0.95
R5328:Eif3l UTSW 15 79093361 nonsense probably null
R6575:Eif3l UTSW 15 79086578 missense possibly damaging 0.67
R6624:Eif3l UTSW 15 79089929 missense probably damaging 1.00
R6875:Eif3l UTSW 15 79085560 missense probably damaging 0.99
R7484:Eif3l UTSW 15 79084136 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGCTTGAGACTCCTGGGTAG -3'
(R):5'- ATCCTGTGCAGACTCCTCAAG -3'

Sequencing Primer
(F):5'- CTCCTGGGTAGGGGTAAAGTG -3'
(R):5'- AAGCTCGACCCTGTCTGC -3'
Posted On2014-11-12