Incidental Mutation 'R0308:Elk3'
ID24984
Institutional Source Beutler Lab
Gene Symbol Elk3
Ensembl Gene ENSMUSG00000008398
Gene NameELK3, member of ETS oncogene family
SynonymsNet, D430049E23Rik, Erp, Sap-2
MMRRC Submission 038518-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R0308 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location93247414-93311135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93265205 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 228 (M228K)
Ref Sequence ENSEMBL: ENSMUSP00000008542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008542] [ENSMUST00000129827] [ENSMUST00000151153] [ENSMUST00000215286] [ENSMUST00000223340]
Predicted Effect probably benign
Transcript: ENSMUST00000008542
AA Change: M228K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000008542
Gene: ENSMUSG00000008398
AA Change: M228K

DomainStartEndE-ValueType
ETS 4 89 1.56e-55 SMART
low complexity region 200 222 N/A INTRINSIC
low complexity region 229 256 N/A INTRINSIC
low complexity region 278 299 N/A INTRINSIC
low complexity region 356 367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129827
SMART Domains Protein: ENSMUSP00000122324
Gene: ENSMUSG00000008398

DomainStartEndE-ValueType
ETS 4 89 1.56e-55 SMART
low complexity region 200 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151153
SMART Domains Protein: ENSMUSP00000121754
Gene: ENSMUSG00000008398

DomainStartEndE-ValueType
ETS 4 80 7.6e-36 SMART
low complexity region 89 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215286
Predicted Effect probably benign
Transcript: ENSMUST00000216729
Predicted Effect probably benign
Transcript: ENSMUST00000223340
Meta Mutation Damage Score 0.0645 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.1%
  • 20x: 89.5%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ETS-domain transcription factor family and the ternary complex factor (TCF) subfamily. Proteins in this subfamily regulate transcription when recruited by serum response factor to bind to serum response elements. This protein is activated by signal-induced phosphorylation; studies in rodents suggest that it is a transcriptional inhibitor in the absence of Ras, but activates transcription when Ras is present. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a null allele develop a vascular defect associated with lymphangiectasis and die prematurely due to respiratory failure resulting from chylothorax. Homozygotes for a different null allele show a transient delay in retinal primary plexus vascularization and tortuous retinal arteries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,989 D65V probably damaging Het
4933407L21Rik A T 1: 85,931,286 probably benign Het
Abcc12 C T 8: 86,557,752 probably benign Het
Adamts12 A G 15: 11,311,560 E1301G probably damaging Het
Adh4 A T 3: 138,424,102 N230Y probably damaging Het
Anapc15-ps T A 10: 95,673,092 M109L probably benign Het
Angpt2 T C 8: 18,692,125 I472V possibly damaging Het
Arhgef26 C A 3: 62,340,399 D301E probably benign Het
Armc10 G A 5: 21,647,297 probably benign Het
Arntl A T 7: 113,291,536 I179F probably damaging Het
Atm T C 9: 53,454,473 probably null Het
Atp5b T C 10: 128,086,039 V265A probably benign Het
Atp8b1 G T 18: 64,545,244 C860* probably null Het
Atrnl1 T G 19: 57,753,288 S1160A probably benign Het
Cep55 A G 19: 38,060,211 E105G possibly damaging Het
Cfap54 C A 10: 92,885,364 D2502Y unknown Het
Cilp2 A G 8: 69,882,993 S452P probably benign Het
Clptm1l A G 13: 73,611,667 D282G possibly damaging Het
Csrp1 C A 1: 135,745,286 T47N probably damaging Het
Cyp2c40 T A 19: 39,777,988 I388F probably damaging Het
Dars C T 1: 128,364,259 R494H probably damaging Het
Dna2 T C 10: 62,956,974 V256A probably damaging Het
Dock7 T C 4: 98,984,814 T1132A probably benign Het
Erich6 A G 3: 58,636,104 F182L probably damaging Het
Fhad1 A G 4: 141,985,593 probably benign Het
Fryl A T 5: 73,041,604 probably benign Het
Fzd9 A T 5: 135,249,406 C542S probably damaging Het
Gba A G 3: 89,208,364 T460A probably benign Het
Gli2 C T 1: 118,842,062 A587T probably benign Het
Gm10037 A G 13: 67,843,113 probably benign Het
Gm11011 C T 2: 169,582,694 probably benign Het
Gm17018 T G 19: 45,577,006 F140V probably damaging Het
Gm9745 T G 13: 8,940,841 probably benign Het
Gmppb A G 9: 108,049,834 E68G probably benign Het
Gpld1 A G 13: 24,962,835 N260S possibly damaging Het
Hipk3 G A 2: 104,433,207 S900L probably damaging Het
Ints6l A T X: 56,481,355 M215L possibly damaging Het
Irx6 T A 8: 92,677,031 L128Q probably damaging Het
Itga10 T C 3: 96,651,464 S373P probably damaging Het
Jak1 T C 4: 101,154,535 probably null Het
Jak2 C T 19: 29,311,757 T1103I probably benign Het
Katnal1 A T 5: 148,878,924 V401D possibly damaging Het
Lrp2 T A 2: 69,482,982 probably benign Het
Map3k13 A G 16: 21,891,988 H7R probably benign Het
Mrgprx3-ps A G 7: 47,310,018 V75A probably benign Het
Nol6 C T 4: 41,123,584 A55T probably benign Het
Olfr881 A G 9: 37,992,845 I118V probably benign Het
Opa1 G A 16: 29,621,531 R818Q probably damaging Het
Opn4 T C 14: 34,597,124 Y168C possibly damaging Het
Phf21a T C 2: 92,330,777 V330A possibly damaging Het
Phykpl A G 11: 51,593,596 probably benign Het
Plcb1 T G 2: 134,813,614 V38G probably benign Het
Plxna4 T A 6: 32,237,768 T593S probably benign Het
Poll A T 19: 45,555,965 I339N probably damaging Het
Rev3l A G 10: 39,824,894 I1796V probably benign Het
Rnf103 G A 6: 71,509,702 R439H probably damaging Het
Rrn3 G A 16: 13,799,882 probably benign Het
Sec14l4 G A 11: 4,041,726 probably benign Het
Sec23a A C 12: 59,007,199 Y4* probably null Het
Senp6 T C 9: 80,132,983 probably null Het
Serpinb6b A T 13: 32,978,237 N221Y probably benign Het
Slc6a2 A G 8: 92,961,360 E38G possibly damaging Het
Smap1 A T 1: 23,849,342 L196I probably damaging Het
Sorbs2 C T 8: 45,795,130 Q473* probably null Het
Sphkap C A 1: 83,276,969 V1020F probably damaging Het
Srfbp1 T C 18: 52,488,542 V225A probably benign Het
Srprb G A 9: 103,202,005 P728S possibly damaging Het
Tarm1 T C 7: 3,496,671 probably benign Het
Tcp1 T A 17: 12,920,419 I162N probably benign Het
Tmem237 C A 1: 59,107,517 A292S probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnpo1 A G 13: 98,846,503 F884L probably damaging Het
Trim7 A G 11: 48,849,501 T142A probably damaging Het
Ttn T A 2: 76,785,680 I14894F probably damaging Het
Tubgcp6 T C 15: 89,122,436 R128G possibly damaging Het
Ube2d2b A G 5: 107,830,908 T142A possibly damaging Het
Unc13c G T 9: 73,481,118 L2129I probably benign Het
Ushbp1 T C 8: 71,391,053 D247G probably damaging Het
Usp43 G A 11: 67,880,140 A556V probably damaging Het
Zfp438 T A 18: 5,213,638 H440L probably benign Het
Zfp518b C T 5: 38,672,770 E631K possibly damaging Het
Other mutations in Elk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Elk3 APN 10 93284827 missense probably damaging 1.00
IGL02566:Elk3 APN 10 93265463 missense probably damaging 1.00
IGL03251:Elk3 APN 10 93254821 splice site probably null
R0594:Elk3 UTSW 10 93265160 missense probably damaging 1.00
R0601:Elk3 UTSW 10 93265481 missense probably damaging 0.98
R1190:Elk3 UTSW 10 93265196 missense probably benign 0.00
R2021:Elk3 UTSW 10 93265677 missense probably damaging 1.00
R2022:Elk3 UTSW 10 93265677 missense probably damaging 1.00
R2418:Elk3 UTSW 10 93284827 missense probably damaging 1.00
R3935:Elk3 UTSW 10 93265173 missense possibly damaging 0.60
R4167:Elk3 UTSW 10 93265335 critical splice donor site probably null
R4168:Elk3 UTSW 10 93265335 critical splice donor site probably null
R4169:Elk3 UTSW 10 93265335 critical splice donor site probably null
R4170:Elk3 UTSW 10 93265335 critical splice donor site probably null
R5864:Elk3 UTSW 10 93284791 missense probably damaging 1.00
R6171:Elk3 UTSW 10 93250044 missense probably damaging 1.00
R6743:Elk3 UTSW 10 93265050 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TTGGAGCCCGATGACAGATTCAGG -3'
(R):5'- TGTCCTCTCTCAAAAGTGCCAGCC -3'

Sequencing Primer
(F):5'- GGGCTCCAGAGAATCCGAG -3'
(R):5'- TTCAAGGCCATCAAGACGG -3'
Posted On2013-04-16