Mutagenetix > Incidental Mutations

Incidental Mutation 'R2442:Vmn2r103'

249841

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r103

Ensembl Gene

ENSMUSG00000091771

Gene Name

vomeronasal 2, receptor 103

Synonyms

EG627636

MMRRC Submission

040400-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R2442 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

19773363-19812536 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 19773531 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 57 (K57E)

Ref Sequence

ENSEMBL: ENSMUSP00000126756 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172203]

Predicted Effect

probably benign
Transcript: ENSMUST00000172203
AA Change: K57E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: K57E

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	82	449	1.3e-37	PFAM
Pfam:NCD3G	509	562	3.5e-22	PFAM
Pfam:7tm_3	595	830	1.1e-51	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	A	G	17: 24,328,632	V256A	probably benign	Het
Acap1	T	C	11: 69,889,491	N42S	possibly damaging	Het
Apoo-ps	C	A	13: 107,414,640		noncoding transcript	Het
Bri3	C	T	5: 144,244,601	T39I	probably benign	Het
Bsn	A	G	9: 108,106,920	S3312P	unknown	Het
Camkmt	C	A	17: 85,090,775	A17E	possibly damaging	Het
Cc2d2a	G	T	5: 43,671,305		probably null	Het
Ccdc122	G	T	14: 77,091,958	M150I	possibly damaging	Het
Celf4	A	G	18: 25,753,459	F57L	probably damaging	Het
Cep192	T	A	18: 67,824,688	F564Y	possibly damaging	Het
Ces1c	T	C	8: 93,123,212	D38G	probably damaging	Het
Cts7	C	A	13: 61,355,617	G178*	probably null	Het
Dcc	A	T	18: 71,456,883	Y681N	probably damaging	Het
Dhx29	A	G	13: 112,946,974	E521G	possibly damaging	Het
Dnase2a	T	C	8: 84,908,993	V35A	probably damaging	Het
Eif3l	A	G	15: 79,085,607	M268V	probably damaging	Het
Foxc1	A	G	13: 31,808,798	M531V	unknown	Het
Grin2c	A	G	11: 115,251,134	Y820H	probably damaging	Het
Ifit1bl1	G	A	19: 34,594,889	A56V	probably benign	Het
Iqsec1	T	C	6: 90,689,883	E524G	possibly damaging	Het
Kcnt2	A	G	1: 140,376,353	I154V	possibly damaging	Het
Kdm1b	T	A	13: 47,062,975	Y274N	probably benign	Het
Kntc1	T	A	5: 123,810,859	L1889Q	probably damaging	Het
Lama1	A	G	17: 67,768,317	T1010A	probably benign	Het
Mmp11	T	C	10: 75,927,245	N171S	probably benign	Het
Myom1	A	G	17: 71,110,735	E1409G	probably damaging	Het
N4bp1	A	G	8: 86,862,040	I90T	probably damaging	Het
Olfr1263	T	C	2: 90,015,341	V137A	probably benign	Het
Plcb4	T	C	2: 135,950,382	S342P	probably damaging	Het
Plg	A	G	17: 12,410,960	E627G	probably benign	Het
Rsf1	CG	CGACGGCGGAG	7: 97,579,908		probably benign	Het
Sla2	G	A	2: 156,875,942	R137C	probably damaging	Het
Slc7a14	A	G	3: 31,230,320	I289T	probably damaging	Het
Srpr	G	A	9: 35,212,001	G43S	possibly damaging	Het
Tbc1d9	T	C	8: 83,166,076	M1T	probably null	Het
Tcte2	A	T	17: 13,714,077	I90N	possibly damaging	Het
Trim30c	G	A	7: 104,382,274	P445S	probably damaging	Het
Trrap	A	G	5: 144,817,966	Q1984R	probably damaging	Het
Ubn2	T	C	6: 38,491,005	S885P	probably benign	Het
Unc45a	A	G	7: 80,339,669	F17S	probably damaging	Het
Uts2b	C	T	16: 27,361,032	V75I	probably benign	Het
Vmn2r82	A	G	10: 79,385,376	S524G	probably damaging	Het

Other mutations in Vmn2r103

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Vmn2r103	APN	17	19793102	missense	probably damaging	0.98
IGL00939:Vmn2r103	APN	17	19794965	missense	probably benign	0.00
IGL01120:Vmn2r103	APN	17	19792997	missense	probably benign	0.06
IGL01403:Vmn2r103	APN	17	19792967	missense	probably benign
IGL01404:Vmn2r103	APN	17	19812434	missense	probably damaging	1.00
IGL01713:Vmn2r103	APN	17	19794068	missense	probably damaging	1.00
IGL01802:Vmn2r103	APN	17	19799208	missense	probably benign
IGL02251:Vmn2r103	APN	17	19793969	missense	possibly damaging	0.84
IGL02466:Vmn2r103	APN	17	19773369	missense	probably benign
IGL02555:Vmn2r103	APN	17	19811611	missense	probably damaging	1.00
IGL02668:Vmn2r103	APN	17	19794127	missense	probably benign	0.03
IGL02715:Vmn2r103	APN	17	19793956	missense	probably damaging	0.97
IGL02735:Vmn2r103	APN	17	19812248	missense	probably benign	0.27
IGL03101:Vmn2r103	APN	17	19773520	missense	probably damaging	0.98
R0003:Vmn2r103	UTSW	17	19811979	missense	probably damaging	0.99
R0052:Vmn2r103	UTSW	17	19811641	missense	probably benign	0.01
R0375:Vmn2r103	UTSW	17	19792859	missense	probably benign	0.06
R0375:Vmn2r103	UTSW	17	19793464	missense	probably benign	0.12
R0755:Vmn2r103	UTSW	17	19773568	missense	probably benign	0.01
R0837:Vmn2r103	UTSW	17	19793927	missense	probably damaging	0.99
R1345:Vmn2r103	UTSW	17	19794247	missense	probably damaging	1.00
R1396:Vmn2r103	UTSW	17	19792968	missense	probably benign
R1488:Vmn2r103	UTSW	17	19793660	missense	probably damaging	0.97
R1533:Vmn2r103	UTSW	17	19773400	missense	probably benign	0.01
R1590:Vmn2r103	UTSW	17	19794234	missense	probably benign
R1928:Vmn2r103	UTSW	17	19811767	missense	possibly damaging	0.95
R1942:Vmn2r103	UTSW	17	19812300	missense	probably benign	0.02
R2071:Vmn2r103	UTSW	17	19793794	missense	probably benign
R2219:Vmn2r103	UTSW	17	19793647	missense	probably damaging	1.00
R2889:Vmn2r103	UTSW	17	19793600	missense	probably damaging	1.00
R3762:Vmn2r103	UTSW	17	19812149	missense	probably damaging	0.98
R4014:Vmn2r103	UTSW	17	19793604	missense	possibly damaging	0.67
R4331:Vmn2r103	UTSW	17	19794233	missense	probably benign	0.00
R4630:Vmn2r103	UTSW	17	19793696	missense	probably benign	0.04
R4631:Vmn2r103	UTSW	17	19793696	missense	probably benign	0.04
R4632:Vmn2r103	UTSW	17	19793696	missense	probably benign	0.04
R4660:Vmn2r103	UTSW	17	19811815	missense	probably damaging	1.00
R4801:Vmn2r103	UTSW	17	19795076	missense	probably benign	0.06
R4802:Vmn2r103	UTSW	17	19795076	missense	probably benign	0.06
R4931:Vmn2r103	UTSW	17	19811769	missense	probably benign	0.01
R4995:Vmn2r103	UTSW	17	19773511	missense	probably benign	0.14
R5309:Vmn2r103	UTSW	17	19793034	missense	probably benign	0.01
R5312:Vmn2r103	UTSW	17	19793034	missense	probably benign	0.01
R5329:Vmn2r103	UTSW	17	19812171	missense	probably damaging	1.00
R5611:Vmn2r103	UTSW	17	19793642	missense	probably damaging	0.99
R5684:Vmn2r103	UTSW	17	19792989	missense	probably benign	0.02
R5715:Vmn2r103	UTSW	17	19794939	missense	probably benign	0.17
R5907:Vmn2r103	UTSW	17	19812453	missense	possibly damaging	0.67
R6029:Vmn2r103	UTSW	17	19794216	nonsense	probably null
R6114:Vmn2r103	UTSW	17	19812325	missense	probably damaging	0.99
R6285:Vmn2r103	UTSW	17	19812144	missense	probably benign
R6292:Vmn2r103	UTSW	17	19793604	missense	possibly damaging	0.67
R6334:Vmn2r103	UTSW	17	19794082	missense	probably damaging	0.97
R6501:Vmn2r103	UTSW	17	19811904	missense	probably benign	0.29
R6710:Vmn2r103	UTSW	17	19811977	missense	probably damaging	1.00
R6774:Vmn2r103	UTSW	17	19773511	missense	probably benign	0.14
R6981:Vmn2r103	UTSW	17	19793477	missense	probably benign	0.00
Z1088:Vmn2r103	UTSW	17	19795047	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- CCATGTATAAATAGGATGTTCACCTGG -3'
(R):5'- TCTGCCTGAGTGAGGAAAATGTTC -3'

Sequencing Primer
(F):5'- CAGGCTCTTGCAAATTCC -3'
(R):5'- CCTGAGTGAGGAAAATGTTCTAAATG -3'

Posted On

2014-11-12