Incidental Mutation 'R2442:Ifit1bl1'
ID249849
Institutional Source Beutler Lab
Gene Symbol Ifit1bl1
Ensembl Gene ENSMUSG00000079339
Gene Nameinterferon induced protein with tetratricpeptide repeats 1B like 1
SynonymsGm14446
MMRRC Submission 040400-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2442 (G1)
Quality Score197
Status Not validated
Chromosome19
Chromosomal Location34592888-34601968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34594889 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 56 (A56V)
Ref Sequence ENSEMBL: ENSMUSP00000132781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112467] [ENSMUST00000168254]
Predicted Effect probably benign
Transcript: ENSMUST00000112467
AA Change: A56V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000108086
Gene: ENSMUSG00000079339
AA Change: A56V

DomainStartEndE-ValueType
TPR 60 93 3.41e1 SMART
TPR 100 133 6.24e1 SMART
TPR 146 179 3.69e1 SMART
low complexity region 217 231 N/A INTRINSIC
TPR 249 282 6.75e1 SMART
TPR 338 371 1.64e1 SMART
low complexity region 417 429 N/A INTRINSIC
TPR 433 466 1.08e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168254
AA Change: A56V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000132781
Gene: ENSMUSG00000079339
AA Change: A56V

DomainStartEndE-ValueType
TPR 60 93 3.41e1 SMART
TPR 100 133 6.24e1 SMART
TPR 146 179 3.69e1 SMART
low complexity region 217 231 N/A INTRINSIC
TPR 249 282 6.75e1 SMART
TPR 338 371 1.64e1 SMART
low complexity region 417 429 N/A INTRINSIC
TPR 433 466 1.08e1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,328,632 V256A probably benign Het
Acap1 T C 11: 69,889,491 N42S possibly damaging Het
Apoo-ps C A 13: 107,414,640 noncoding transcript Het
Bri3 C T 5: 144,244,601 T39I probably benign Het
Bsn A G 9: 108,106,920 S3312P unknown Het
Camkmt C A 17: 85,090,775 A17E possibly damaging Het
Cc2d2a G T 5: 43,671,305 probably null Het
Ccdc122 G T 14: 77,091,958 M150I possibly damaging Het
Celf4 A G 18: 25,753,459 F57L probably damaging Het
Cep192 T A 18: 67,824,688 F564Y possibly damaging Het
Ces1c T C 8: 93,123,212 D38G probably damaging Het
Cts7 C A 13: 61,355,617 G178* probably null Het
Dcc A T 18: 71,456,883 Y681N probably damaging Het
Dhx29 A G 13: 112,946,974 E521G possibly damaging Het
Dnase2a T C 8: 84,908,993 V35A probably damaging Het
Eif3l A G 15: 79,085,607 M268V probably damaging Het
Foxc1 A G 13: 31,808,798 M531V unknown Het
Grin2c A G 11: 115,251,134 Y820H probably damaging Het
Iqsec1 T C 6: 90,689,883 E524G possibly damaging Het
Kcnt2 A G 1: 140,376,353 I154V possibly damaging Het
Kdm1b T A 13: 47,062,975 Y274N probably benign Het
Kntc1 T A 5: 123,810,859 L1889Q probably damaging Het
Lama1 A G 17: 67,768,317 T1010A probably benign Het
Mmp11 T C 10: 75,927,245 N171S probably benign Het
Myom1 A G 17: 71,110,735 E1409G probably damaging Het
N4bp1 A G 8: 86,862,040 I90T probably damaging Het
Olfr1263 T C 2: 90,015,341 V137A probably benign Het
Plcb4 T C 2: 135,950,382 S342P probably damaging Het
Plg A G 17: 12,410,960 E627G probably benign Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc7a14 A G 3: 31,230,320 I289T probably damaging Het
Srpr G A 9: 35,212,001 G43S possibly damaging Het
Tbc1d9 T C 8: 83,166,076 M1T probably null Het
Tcte2 A T 17: 13,714,077 I90N possibly damaging Het
Trim30c G A 7: 104,382,274 P445S probably damaging Het
Trrap A G 5: 144,817,966 Q1984R probably damaging Het
Ubn2 T C 6: 38,491,005 S885P probably benign Het
Unc45a A G 7: 80,339,669 F17S probably damaging Het
Uts2b C T 16: 27,361,032 V75I probably benign Het
Vmn2r103 A G 17: 19,773,531 K57E probably benign Het
Vmn2r82 A G 10: 79,385,376 S524G probably damaging Het
Other mutations in Ifit1bl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4544001:Ifit1bl1 UTSW 19 34594015 missense possibly damaging 0.79
R0420:Ifit1bl1 UTSW 19 34594514 missense probably damaging 1.00
R1161:Ifit1bl1 UTSW 19 34593696 missense possibly damaging 0.80
R1310:Ifit1bl1 UTSW 19 34593696 missense possibly damaging 0.80
R1483:Ifit1bl1 UTSW 19 34594641 missense possibly damaging 0.88
R1606:Ifit1bl1 UTSW 19 34594044 missense probably benign 0.00
R1753:Ifit1bl1 UTSW 19 34593860 missense probably benign 0.15
R1778:Ifit1bl1 UTSW 19 34594193 missense probably damaging 1.00
R2204:Ifit1bl1 UTSW 19 34594341 missense probably benign 0.23
R2205:Ifit1bl1 UTSW 19 34594341 missense probably benign 0.23
R2858:Ifit1bl1 UTSW 19 34594322 missense probably benign 0.01
R3422:Ifit1bl1 UTSW 19 34593950 missense probably benign 0.04
R4081:Ifit1bl1 UTSW 19 34594640 missense possibly damaging 0.63
R4125:Ifit1bl1 UTSW 19 34594788 missense probably damaging 0.99
R4616:Ifit1bl1 UTSW 19 34594610 missense probably damaging 1.00
R4731:Ifit1bl1 UTSW 19 34594321 missense probably benign 0.02
R4732:Ifit1bl1 UTSW 19 34594321 missense probably benign 0.02
R4849:Ifit1bl1 UTSW 19 34594676 missense probably damaging 1.00
R5026:Ifit1bl1 UTSW 19 34593893 missense probably damaging 1.00
R5049:Ifit1bl1 UTSW 19 34594081 nonsense probably null
R5414:Ifit1bl1 UTSW 19 34593924 missense probably damaging 0.99
R5561:Ifit1bl1 UTSW 19 34593797 nonsense probably null
R5586:Ifit1bl1 UTSW 19 34594277 missense probably damaging 0.98
R6345:Ifit1bl1 UTSW 19 34594170 nonsense probably null
R6382:Ifit1bl1 UTSW 19 34594883 missense probably benign 0.16
R6515:Ifit1bl1 UTSW 19 34594499 missense probably damaging 1.00
R7073:Ifit1bl1 UTSW 19 34599267 critical splice donor site probably null
R7180:Ifit1bl1 UTSW 19 34593902 missense probably damaging 1.00
R7210:Ifit1bl1 UTSW 19 34594164 missense probably benign 0.00
R7665:Ifit1bl1 UTSW 19 34594883 missense probably benign 0.16
R7724:Ifit1bl1 UTSW 19 34594005 missense probably benign 0.00
R7783:Ifit1bl1 UTSW 19 34593936 missense probably benign 0.01
R7944:Ifit1bl1 UTSW 19 34593824 missense probably benign 0.00
R8251:Ifit1bl1 UTSW 19 34594832 missense possibly damaging 0.85
R8427:Ifit1bl1 UTSW 19 34599266 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGAAAATTCCTTGCACACCTTC -3'
(R):5'- TGTGGTTTGTCCCCAGTACAC -3'

Sequencing Primer
(F):5'- CAAGCTGCCCCTGTGGTAATG -3'
(R):5'- GGTTTGTCCCCAGTACACAGAATTTG -3'
Posted On2014-11-12