Incidental Mutation 'R2443:Olfr1157'
ID249854
Institutional Source Beutler Lab
Gene Symbol Olfr1157
Ensembl Gene ENSMUSG00000075143
Gene Nameolfactory receptor 1157
SynonymsMOR174-1, GA_x6K02T2Q125-49446395-49445457
MMRRC Submission 040401-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R2443 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87958485-87968299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87962865 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 9 (V9E)
Ref Sequence ENSEMBL: ENSMUSP00000097429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099841]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099841
AA Change: V9E

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097429
Gene: ENSMUSG00000075143
AA Change: V9E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.7e-48 PFAM
Pfam:7tm_1 41 290 2.6e-20 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,481,349 N239K probably damaging Het
Anapc13 C T 9: 102,634,023 P37S probably damaging Het
Asxl3 T A 18: 22,411,539 D39E probably benign Het
Clec4d G A 6: 123,268,117 V119M probably benign Het
Dlx2 A G 2: 71,546,005 S130P probably benign Het
Dync2li1 C A 17: 84,647,665 Q251K probably benign Het
E330009J07Rik T C 6: 40,406,776 D444G probably damaging Het
Edem1 A T 6: 108,851,269 K518N probably benign Het
Fbln2 T C 6: 91,259,711 V736A probably damaging Het
Fga A G 3: 83,028,541 K25R probably benign Het
Hmcn1 C A 1: 150,599,032 R4701S probably benign Het
Ighv8-5 G A 12: 115,067,820 P33L probably damaging Het
Kcnip3 T A 2: 127,460,063 I194F probably damaging Het
Kif26b A C 1: 178,915,014 I892L probably damaging Het
Krt78 C T 15: 101,946,598 G926E probably damaging Het
Maats1 A G 16: 38,302,732 Y645H probably damaging Het
Map1b T C 13: 99,430,411 Y1934C unknown Het
Masp1 A T 16: 23,476,312 Y400N probably damaging Het
Methig1 T C 15: 100,353,211 M1T probably null Het
Mmp19 A G 10: 128,798,856 E447G possibly damaging Het
Ms4a6d G A 19: 11,590,193 H115Y possibly damaging Het
Myo1e C T 9: 70,327,172 S269L probably benign Het
Myo7a G A 7: 98,095,769 T288I probably benign Het
Npy5r T A 8: 66,681,290 K284* probably null Het
Oas3 C A 5: 120,777,488 R46L probably benign Het
Pkd1l3 T A 8: 109,623,815 S431T probably benign Het
Pnpla2 T C 7: 141,458,069 V184A possibly damaging Het
Pomt2 C A 12: 87,133,380 K282N probably damaging Het
Psmd12 T A 11: 107,495,737 M378K probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Strn3 A T 12: 51,627,835 Y389N probably damaging Het
Tdrd1 C T 19: 56,841,354 A220V probably null Het
Tecpr2 T G 12: 110,896,325 L57R probably damaging Het
Tkfc A G 19: 10,594,538 L378P probably damaging Het
Tmprss2 T G 16: 97,568,503 D357A possibly damaging Het
Tollip C T 7: 141,890,823 W64* probably null Het
Vcan A G 13: 89,704,675 F722S probably damaging Het
Vcp A T 4: 42,983,385 N558K probably damaging Het
Vmn1r232 A G 17: 20,913,384 I318T probably damaging Het
Vmn1r33 A T 6: 66,611,973 I199K possibly damaging Het
Zfp61 A G 7: 24,291,769 V319A probably benign Het
Zfyve28 A G 5: 34,216,894 V592A possibly damaging Het
Other mutations in Olfr1157
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4453001:Olfr1157 UTSW 2 87962458 missense possibly damaging 0.90
R1502:Olfr1157 UTSW 2 87962035 missense probably damaging 1.00
R2127:Olfr1157 UTSW 2 87962832 missense probably benign 0.01
R2284:Olfr1157 UTSW 2 87962793 missense probably damaging 0.99
R4021:Olfr1157 UTSW 2 87962722 missense possibly damaging 0.77
R4693:Olfr1157 UTSW 2 87962709 missense probably benign 0.39
R4752:Olfr1157 UTSW 2 87962349 missense probably damaging 1.00
R4879:Olfr1157 UTSW 2 87962696 missense possibly damaging 0.91
R4983:Olfr1157 UTSW 2 87962698 missense probably benign 0.26
R5592:Olfr1157 UTSW 2 87962340 missense probably damaging 1.00
R5945:Olfr1157 UTSW 2 87962602 missense probably damaging 1.00
R6412:Olfr1157 UTSW 2 87962349 missense probably damaging 1.00
R7470:Olfr1157 UTSW 2 87962449 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TCCACAAAGGACAGATGGCTG -3'
(R):5'- CTTCTGAGTTCAATCGTGGGTTTAAC -3'

Sequencing Primer
(F):5'- GGCGGTGACTCCATAAAT -3'
(R):5'- GTTCAATCGTGGGTTTAACTACTTC -3'
Posted On2014-11-12