Incidental Mutation 'R2443:Kcnip3'
ID249855
Institutional Source Beutler Lab
Gene Symbol Kcnip3
Ensembl Gene ENSMUSG00000079056
Gene NameKv channel interacting protein 3, calsenilin
SynonymsCsen, KChIP3, R74849, DREAM, 4933407H12Rik
MMRRC Submission 040401-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2443 (G1)
Quality Score148
Status Not validated
Chromosome2
Chromosomal Location127456498-127522094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127460063 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 194 (I194F)
Ref Sequence ENSEMBL: ENSMUSP00000099504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028850] [ENSMUST00000088538] [ENSMUST00000103215]
PDB Structure
NMR Structure of DREAM [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000028850
AA Change: I222F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028850
Gene: ENSMUSG00000079056
AA Change: I222F

DomainStartEndE-ValueType
EFh 158 186 1.74e-1 SMART
EFh 194 222 3.82e-7 SMART
EFh 242 270 3.79e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000088538
AA Change: I168F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085896
Gene: ENSMUSG00000079056
AA Change: I168F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
EFh 104 132 1.74e-1 SMART
EFh 140 168 3.82e-7 SMART
EFh 188 216 3.79e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103215
AA Change: I194F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099504
Gene: ENSMUSG00000079056
AA Change: I194F

DomainStartEndE-ValueType
low complexity region 60 70 N/A INTRINSIC
EFh 130 158 1.74e-1 SMART
EFh 166 194 3.82e-7 SMART
EFh 214 242 3.79e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137625
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of voltage-gated potassium (Kv) channel-interacting proteins, which belong to the recoverin branch of the EF-hand superfamily. Members of this family are small calcium binding proteins containing EF-hand-like domains. They are integral subunit components of native Kv4 channel complexes that may regulate A-type currents, and hence neuronal excitability, in response to changes in intracellular calcium. The encoded protein also functions as a calcium-regulated transcriptional repressor, and interacts with presenilins. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal spatial learning, hyperactivity, hypophagia, increased sensitivity to shock, and enhanced long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,481,349 N239K probably damaging Het
Anapc13 C T 9: 102,634,023 P37S probably damaging Het
Asxl3 T A 18: 22,411,539 D39E probably benign Het
Clec4d G A 6: 123,268,117 V119M probably benign Het
Dlx2 A G 2: 71,546,005 S130P probably benign Het
Dync2li1 C A 17: 84,647,665 Q251K probably benign Het
E330009J07Rik T C 6: 40,406,776 D444G probably damaging Het
Edem1 A T 6: 108,851,269 K518N probably benign Het
Fbln2 T C 6: 91,259,711 V736A probably damaging Het
Fga A G 3: 83,028,541 K25R probably benign Het
Hmcn1 C A 1: 150,599,032 R4701S probably benign Het
Ighv8-5 G A 12: 115,067,820 P33L probably damaging Het
Kif26b A C 1: 178,915,014 I892L probably damaging Het
Krt78 C T 15: 101,946,598 G926E probably damaging Het
Maats1 A G 16: 38,302,732 Y645H probably damaging Het
Map1b T C 13: 99,430,411 Y1934C unknown Het
Masp1 A T 16: 23,476,312 Y400N probably damaging Het
Methig1 T C 15: 100,353,211 M1T probably null Het
Mmp19 A G 10: 128,798,856 E447G possibly damaging Het
Ms4a6d G A 19: 11,590,193 H115Y possibly damaging Het
Myo1e C T 9: 70,327,172 S269L probably benign Het
Myo7a G A 7: 98,095,769 T288I probably benign Het
Npy5r T A 8: 66,681,290 K284* probably null Het
Oas3 C A 5: 120,777,488 R46L probably benign Het
Olfr1157 A T 2: 87,962,865 V9E possibly damaging Het
Pkd1l3 T A 8: 109,623,815 S431T probably benign Het
Pnpla2 T C 7: 141,458,069 V184A possibly damaging Het
Pomt2 C A 12: 87,133,380 K282N probably damaging Het
Psmd12 T A 11: 107,495,737 M378K probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Strn3 A T 12: 51,627,835 Y389N probably damaging Het
Tdrd1 C T 19: 56,841,354 A220V probably null Het
Tecpr2 T G 12: 110,896,325 L57R probably damaging Het
Tkfc A G 19: 10,594,538 L378P probably damaging Het
Tmprss2 T G 16: 97,568,503 D357A possibly damaging Het
Tollip C T 7: 141,890,823 W64* probably null Het
Vcan A G 13: 89,704,675 F722S probably damaging Het
Vcp A T 4: 42,983,385 N558K probably damaging Het
Vmn1r232 A G 17: 20,913,384 I318T probably damaging Het
Vmn1r33 A T 6: 66,611,973 I199K possibly damaging Het
Zfp61 A G 7: 24,291,769 V319A probably benign Het
Zfyve28 A G 5: 34,216,894 V592A possibly damaging Het
Other mutations in Kcnip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Kcnip3 APN 2 127510879 missense probably benign 0.44
R0277:Kcnip3 UTSW 2 127459979 splice site probably benign
R0410:Kcnip3 UTSW 2 127460066 missense probably damaging 1.00
R0601:Kcnip3 UTSW 2 127458397 splice site probably benign
R1183:Kcnip3 UTSW 2 127465065 missense probably damaging 1.00
R1868:Kcnip3 UTSW 2 127459343 missense probably damaging 1.00
R2265:Kcnip3 UTSW 2 127465061 missense probably benign 0.40
R3797:Kcnip3 UTSW 2 127482014 missense probably benign 0.01
R5077:Kcnip3 UTSW 2 127465877 missense probably damaging 0.99
R6834:Kcnip3 UTSW 2 127458358 missense probably damaging 1.00
R7084:Kcnip3 UTSW 2 127510936 missense probably benign
R7234:Kcnip3 UTSW 2 127521336 missense unknown
R7813:Kcnip3 UTSW 2 127481783 splice site probably null
R8130:Kcnip3 UTSW 2 127510908 missense possibly damaging 0.85
R8178:Kcnip3 UTSW 2 127482014 missense probably benign 0.01
Z1177:Kcnip3 UTSW 2 127510881 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGAAGCCTAGTTGCATCTC -3'
(R):5'- TCATAACTTCTTGTTTCGGAGGC -3'

Sequencing Primer
(F):5'- TCCTCACTGGCACTGGTTGAAG -3'
(R):5'- TTCGGAGGCAGGTTCATAAATCC -3'
Posted On2014-11-12