Incidental Mutation 'R2443:Vcp'
ID249860
Institutional Source Beutler Lab
Gene Symbol Vcp
Ensembl Gene ENSMUSG00000028452
Gene Namevalosin containing protein
SynonymsAAA ATPase p97, p97/VCP, p97, CDC48
MMRRC Submission 040401-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2443 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location42979963-43000507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42983385 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 558 (N558K)
Ref Sequence ENSEMBL: ENSMUSP00000030164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030164] [ENSMUST00000139127]
PDB Structure
STRUCTURE OF THE N-TERMINAL DOMAIN AND THE D1 AAA DOMAIN OF MEMBRANE FUSION ATPASE P97 [X-RAY DIFFRACTION]
The crystal structure of murine p97/VCP at 3.6A [X-RAY DIFFRACTION]
Crystal structure of AAA ATPase p97/VCP ND1 in complex with p47 C [X-RAY DIFFRACTION]
Strctural Model of the p97 N domain- npl4 UBD complex [SOLUTION NMR]
Structure of D2 subdomain of P97/VCP in complex with ADP [X-RAY DIFFRACTION]
Structure of P97/vcp in complex with ADP/ADP.alfx [X-RAY DIFFRACTION]
Structure of P97/vcp in complex with ADP/AMP-PNP [X-RAY DIFFRACTION]
Structure of P97/vcp in complex with ADP [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000030164
AA Change: N558K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030164
Gene: ENSMUSG00000028452
AA Change: N558K

DomainStartEndE-ValueType
CDC48_N 25 108 6.85e-27 SMART
CDC48_2 125 191 3.77e-15 SMART
AAA 237 373 7.87e-24 SMART
AAA 510 649 2e-25 SMART
Pfam:Vps4_C 710 762 3.5e-7 PFAM
low complexity region 775 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139127
SMART Domains Protein: ENSMUSP00000116415
Gene: ENSMUSG00000028451

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154541
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family that includes putative ATP-binding proteins involved in vesicle transport and fusion, 26S proteasome function, and assembly of peroxisomes. This protein, as a structural protein, is associated with clathrin, and heat-shock protein Hsc70, to form a complex. It has been implicated in a number of cellular events that are regulated during mitosis, including homotypic membrane fusion, spindle pole body function, and ubiquitin-dependent protein degradation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality before weaning. Mice homozygous for a knock-in allele exhibit progressive muscle weakness, myopathy, decreased bone density, increased osteoclast genesis, and seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,481,349 N239K probably damaging Het
Anapc13 C T 9: 102,634,023 P37S probably damaging Het
Asxl3 T A 18: 22,411,539 D39E probably benign Het
Clec4d G A 6: 123,268,117 V119M probably benign Het
Dlx2 A G 2: 71,546,005 S130P probably benign Het
Dync2li1 C A 17: 84,647,665 Q251K probably benign Het
E330009J07Rik T C 6: 40,406,776 D444G probably damaging Het
Edem1 A T 6: 108,851,269 K518N probably benign Het
Fbln2 T C 6: 91,259,711 V736A probably damaging Het
Fga A G 3: 83,028,541 K25R probably benign Het
Hmcn1 C A 1: 150,599,032 R4701S probably benign Het
Ighv8-5 G A 12: 115,067,820 P33L probably damaging Het
Kcnip3 T A 2: 127,460,063 I194F probably damaging Het
Kif26b A C 1: 178,915,014 I892L probably damaging Het
Krt78 C T 15: 101,946,598 G926E probably damaging Het
Maats1 A G 16: 38,302,732 Y645H probably damaging Het
Map1b T C 13: 99,430,411 Y1934C unknown Het
Masp1 A T 16: 23,476,312 Y400N probably damaging Het
Methig1 T C 15: 100,353,211 M1T probably null Het
Mmp19 A G 10: 128,798,856 E447G possibly damaging Het
Ms4a6d G A 19: 11,590,193 H115Y possibly damaging Het
Myo1e C T 9: 70,327,172 S269L probably benign Het
Myo7a G A 7: 98,095,769 T288I probably benign Het
Npy5r T A 8: 66,681,290 K284* probably null Het
Oas3 C A 5: 120,777,488 R46L probably benign Het
Olfr1157 A T 2: 87,962,865 V9E possibly damaging Het
Pkd1l3 T A 8: 109,623,815 S431T probably benign Het
Pnpla2 T C 7: 141,458,069 V184A possibly damaging Het
Pomt2 C A 12: 87,133,380 K282N probably damaging Het
Psmd12 T A 11: 107,495,737 M378K probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Strn3 A T 12: 51,627,835 Y389N probably damaging Het
Tdrd1 C T 19: 56,841,354 A220V probably null Het
Tecpr2 T G 12: 110,896,325 L57R probably damaging Het
Tkfc A G 19: 10,594,538 L378P probably damaging Het
Tmprss2 T G 16: 97,568,503 D357A possibly damaging Het
Tollip C T 7: 141,890,823 W64* probably null Het
Vcan A G 13: 89,704,675 F722S probably damaging Het
Vmn1r232 A G 17: 20,913,384 I318T probably damaging Het
Vmn1r33 A T 6: 66,611,973 I199K possibly damaging Het
Zfp61 A G 7: 24,291,769 V319A probably benign Het
Zfyve28 A G 5: 34,216,894 V592A possibly damaging Het
Other mutations in Vcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01460:Vcp APN 4 42996040 missense possibly damaging 0.69
IGL02251:Vcp APN 4 42988728 missense possibly damaging 0.49
H8562:Vcp UTSW 4 42982596 missense probably damaging 1.00
R0627:Vcp UTSW 4 42983011 missense possibly damaging 0.83
R0639:Vcp UTSW 4 42982565 missense probably benign 0.00
R0711:Vcp UTSW 4 42986201 missense probably benign 0.22
R0766:Vcp UTSW 4 42988728 missense possibly damaging 0.49
R1312:Vcp UTSW 4 42988728 missense possibly damaging 0.49
R1702:Vcp UTSW 4 42990840 missense probably damaging 1.00
R2071:Vcp UTSW 4 42995894 critical splice donor site probably null
R2192:Vcp UTSW 4 42982547 missense probably benign
R2262:Vcp UTSW 4 42980828 missense probably benign 0.04
R2265:Vcp UTSW 4 42980833 missense possibly damaging 0.93
R2268:Vcp UTSW 4 42980833 missense possibly damaging 0.93
R2269:Vcp UTSW 4 42980833 missense possibly damaging 0.93
R2937:Vcp UTSW 4 42980846 missense probably damaging 1.00
R2973:Vcp UTSW 4 42996315 missense probably damaging 1.00
R4004:Vcp UTSW 4 42983028 missense probably damaging 1.00
R4488:Vcp UTSW 4 42993826 missense probably damaging 0.96
R4546:Vcp UTSW 4 42988813 intron probably benign
R4578:Vcp UTSW 4 42984565 missense probably benign 0.41
R4817:Vcp UTSW 4 42983486 missense probably damaging 1.00
R4869:Vcp UTSW 4 42993691 missense probably benign 0.00
R5014:Vcp UTSW 4 42980828 missense probably benign 0.04
R6128:Vcp UTSW 4 42980941 missense probably benign 0.00
R6594:Vcp UTSW 4 42993826 missense probably damaging 0.96
R7105:Vcp UTSW 4 42985991 missense probably damaging 1.00
R7470:Vcp UTSW 4 42982891 missense probably damaging 1.00
R8006:Vcp UTSW 4 42985993 missense probably benign 0.04
R8234:Vcp UTSW 4 42985242 missense probably damaging 1.00
R8313:Vcp UTSW 4 42988728 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ACAACTAGATTTCTCAGGCTTCAG -3'
(R):5'- TCTTGTAGTATCCTGTGGAACATCC -3'

Sequencing Primer
(F):5'- TTCTCAGGCTTCAGAAAGAAAATCC -3'
(R):5'- TGGAACATCCAGACAAATTCCTC -3'
Posted On2014-11-12