Incidental Mutation 'R2443:Zfyve28'
ID249861
Institutional Source Beutler Lab
Gene Symbol Zfyve28
Ensembl Gene ENSMUSG00000037224
Gene Namezinc finger, FYVE domain containing 28
Synonyms9630058O20Rik
MMRRC Submission 040401-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2443 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location34194893-34288449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34216894 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 592 (V592A)
Ref Sequence ENSEMBL: ENSMUSP00000092464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094868]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094868
AA Change: V592A

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092464
Gene: ENSMUSG00000037224
AA Change: V592A

DomainStartEndE-ValueType
low complexity region 718 730 N/A INTRINSIC
FYVE 827 896 8.73e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201477
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,481,349 N239K probably damaging Het
Anapc13 C T 9: 102,634,023 P37S probably damaging Het
Asxl3 T A 18: 22,411,539 D39E probably benign Het
Clec4d G A 6: 123,268,117 V119M probably benign Het
Dlx2 A G 2: 71,546,005 S130P probably benign Het
Dync2li1 C A 17: 84,647,665 Q251K probably benign Het
E330009J07Rik T C 6: 40,406,776 D444G probably damaging Het
Edem1 A T 6: 108,851,269 K518N probably benign Het
Fbln2 T C 6: 91,259,711 V736A probably damaging Het
Fga A G 3: 83,028,541 K25R probably benign Het
Hmcn1 C A 1: 150,599,032 R4701S probably benign Het
Ighv8-5 G A 12: 115,067,820 P33L probably damaging Het
Kcnip3 T A 2: 127,460,063 I194F probably damaging Het
Kif26b A C 1: 178,915,014 I892L probably damaging Het
Krt78 C T 15: 101,946,598 G926E probably damaging Het
Maats1 A G 16: 38,302,732 Y645H probably damaging Het
Map1b T C 13: 99,430,411 Y1934C unknown Het
Masp1 A T 16: 23,476,312 Y400N probably damaging Het
Methig1 T C 15: 100,353,211 M1T probably null Het
Mmp19 A G 10: 128,798,856 E447G possibly damaging Het
Ms4a6d G A 19: 11,590,193 H115Y possibly damaging Het
Myo1e C T 9: 70,327,172 S269L probably benign Het
Myo7a G A 7: 98,095,769 T288I probably benign Het
Npy5r T A 8: 66,681,290 K284* probably null Het
Oas3 C A 5: 120,777,488 R46L probably benign Het
Olfr1157 A T 2: 87,962,865 V9E possibly damaging Het
Pkd1l3 T A 8: 109,623,815 S431T probably benign Het
Pnpla2 T C 7: 141,458,069 V184A possibly damaging Het
Pomt2 C A 12: 87,133,380 K282N probably damaging Het
Psmd12 T A 11: 107,495,737 M378K probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Strn3 A T 12: 51,627,835 Y389N probably damaging Het
Tdrd1 C T 19: 56,841,354 A220V probably null Het
Tecpr2 T G 12: 110,896,325 L57R probably damaging Het
Tkfc A G 19: 10,594,538 L378P probably damaging Het
Tmprss2 T G 16: 97,568,503 D357A possibly damaging Het
Tollip C T 7: 141,890,823 W64* probably null Het
Vcan A G 13: 89,704,675 F722S probably damaging Het
Vcp A T 4: 42,983,385 N558K probably damaging Het
Vmn1r232 A G 17: 20,913,384 I318T probably damaging Het
Vmn1r33 A T 6: 66,611,973 I199K possibly damaging Het
Zfp61 A G 7: 24,291,769 V319A probably benign Het
Other mutations in Zfyve28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Zfyve28 APN 5 34243195 missense probably damaging 0.98
IGL02201:Zfyve28 APN 5 34243205 missense probably damaging 1.00
PIT4418001:Zfyve28 UTSW 5 34233377 missense probably damaging 1.00
R0499:Zfyve28 UTSW 5 34232206 missense possibly damaging 0.65
R1226:Zfyve28 UTSW 5 34217064 missense probably benign 0.00
R1290:Zfyve28 UTSW 5 34198801 missense probably benign 0.00
R1351:Zfyve28 UTSW 5 34232205 missense probably damaging 1.00
R1418:Zfyve28 UTSW 5 34217246 missense probably damaging 0.99
R2062:Zfyve28 UTSW 5 34234337 missense probably null 0.73
R2212:Zfyve28 UTSW 5 34199684 missense probably benign 0.02
R2851:Zfyve28 UTSW 5 34196662 missense probably damaging 1.00
R2852:Zfyve28 UTSW 5 34196662 missense probably damaging 1.00
R3412:Zfyve28 UTSW 5 34199684 missense probably benign 0.02
R3413:Zfyve28 UTSW 5 34199684 missense probably benign 0.02
R3694:Zfyve28 UTSW 5 34217468 missense probably damaging 1.00
R4645:Zfyve28 UTSW 5 34222443 intron probably benign
R4700:Zfyve28 UTSW 5 34217845 missense probably damaging 1.00
R4938:Zfyve28 UTSW 5 34233354 missense probably damaging 0.99
R5384:Zfyve28 UTSW 5 34216967 missense probably damaging 1.00
R5908:Zfyve28 UTSW 5 34216870 missense possibly damaging 0.62
R5936:Zfyve28 UTSW 5 34224988 missense probably damaging 1.00
R6260:Zfyve28 UTSW 5 34198872 missense probably damaging 0.99
R6862:Zfyve28 UTSW 5 34288105 missense probably benign 0.10
R7172:Zfyve28 UTSW 5 34234409 missense probably benign 0.42
R7243:Zfyve28 UTSW 5 34198875 missense probably damaging 1.00
R7366:Zfyve28 UTSW 5 34232227 missense probably damaging 1.00
R7598:Zfyve28 UTSW 5 34236117 missense probably damaging 1.00
R7654:Zfyve28 UTSW 5 34243195 missense probably damaging 1.00
R7752:Zfyve28 UTSW 5 34224982 missense probably damaging 1.00
R7861:Zfyve28 UTSW 5 34217143 missense probably damaging 1.00
R7878:Zfyve28 UTSW 5 34199655 missense probably damaging 1.00
R7901:Zfyve28 UTSW 5 34224982 missense probably damaging 1.00
R8116:Zfyve28 UTSW 5 34217600 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAACAGGTGCTGGTGTTCTG -3'
(R):5'- TGGTACTTCCCCTTTGGAGC -3'

Sequencing Primer
(F):5'- TGACCACAGGGGACTTCTCAG -3'
(R):5'- TTCCCCTTTGGAGCCCAGG -3'
Posted On2014-11-12