Incidental Mutation 'R2443:E330009J07Rik'
ID249863
Institutional Source Beutler Lab
Gene Symbol E330009J07Rik
Ensembl Gene ENSMUSG00000037172
Gene NameRIKEN cDNA E330009J07 gene
Synonyms
MMRRC Submission 040401-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R2443 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location40401375-40436135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40406776 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 444 (D444G)
Ref Sequence ENSEMBL: ENSMUSP00000099031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039008] [ENSMUST00000101492]
Predicted Effect probably benign
Transcript: ENSMUST00000039008
SMART Domains Protein: ENSMUSP00000045103
Gene: ENSMUSG00000037172

DomainStartEndE-ValueType
low complexity region 30 60 N/A INTRINSIC
Pfam:DUF2347 80 347 3.4e-79 PFAM
Pfam:SPA 234 345 5.2e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101492
AA Change: D444G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099031
Gene: ENSMUSG00000037172
AA Change: D444G

DomainStartEndE-ValueType
low complexity region 30 60 N/A INTRINSIC
Pfam:DUF2347 80 347 3.2e-78 PFAM
Pfam:SPA 234 345 6.3e-16 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,481,349 N239K probably damaging Het
Anapc13 C T 9: 102,634,023 P37S probably damaging Het
Asxl3 T A 18: 22,411,539 D39E probably benign Het
Clec4d G A 6: 123,268,117 V119M probably benign Het
Dlx2 A G 2: 71,546,005 S130P probably benign Het
Dync2li1 C A 17: 84,647,665 Q251K probably benign Het
Edem1 A T 6: 108,851,269 K518N probably benign Het
Fbln2 T C 6: 91,259,711 V736A probably damaging Het
Fga A G 3: 83,028,541 K25R probably benign Het
Hmcn1 C A 1: 150,599,032 R4701S probably benign Het
Ighv8-5 G A 12: 115,067,820 P33L probably damaging Het
Kcnip3 T A 2: 127,460,063 I194F probably damaging Het
Kif26b A C 1: 178,915,014 I892L probably damaging Het
Krt78 C T 15: 101,946,598 G926E probably damaging Het
Maats1 A G 16: 38,302,732 Y645H probably damaging Het
Map1b T C 13: 99,430,411 Y1934C unknown Het
Masp1 A T 16: 23,476,312 Y400N probably damaging Het
Methig1 T C 15: 100,353,211 M1T probably null Het
Mmp19 A G 10: 128,798,856 E447G possibly damaging Het
Ms4a6d G A 19: 11,590,193 H115Y possibly damaging Het
Myo1e C T 9: 70,327,172 S269L probably benign Het
Myo7a G A 7: 98,095,769 T288I probably benign Het
Npy5r T A 8: 66,681,290 K284* probably null Het
Oas3 C A 5: 120,777,488 R46L probably benign Het
Olfr1157 A T 2: 87,962,865 V9E possibly damaging Het
Pkd1l3 T A 8: 109,623,815 S431T probably benign Het
Pnpla2 T C 7: 141,458,069 V184A possibly damaging Het
Pomt2 C A 12: 87,133,380 K282N probably damaging Het
Psmd12 T A 11: 107,495,737 M378K probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Strn3 A T 12: 51,627,835 Y389N probably damaging Het
Tdrd1 C T 19: 56,841,354 A220V probably null Het
Tecpr2 T G 12: 110,896,325 L57R probably damaging Het
Tkfc A G 19: 10,594,538 L378P probably damaging Het
Tmprss2 T G 16: 97,568,503 D357A possibly damaging Het
Tollip C T 7: 141,890,823 W64* probably null Het
Vcan A G 13: 89,704,675 F722S probably damaging Het
Vcp A T 4: 42,983,385 N558K probably damaging Het
Vmn1r232 A G 17: 20,913,384 I318T probably damaging Het
Vmn1r33 A T 6: 66,611,973 I199K possibly damaging Het
Zfp61 A G 7: 24,291,769 V319A probably benign Het
Zfyve28 A G 5: 34,216,894 V592A possibly damaging Het
Other mutations in E330009J07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02813:E330009J07Rik APN 6 40418539 missense probably benign 0.00
IGL03143:E330009J07Rik APN 6 40422894 splice site probably benign
R1812:E330009J07Rik UTSW 6 40409431 missense probably benign 0.02
R1928:E330009J07Rik UTSW 6 40411714 missense probably benign 0.14
R3012:E330009J07Rik UTSW 6 40435992 missense probably benign
R6913:E330009J07Rik UTSW 6 40406917 missense possibly damaging 0.91
R7318:E330009J07Rik UTSW 6 40409164 missense possibly damaging 0.72
R7456:E330009J07Rik UTSW 6 40406840 missense probably benign 0.33
R8087:E330009J07Rik UTSW 6 40418592 missense possibly damaging 0.94
R8231:E330009J07Rik UTSW 6 40418612 missense probably benign 0.35
Y4340:E330009J07Rik UTSW 6 40436058 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGACAGTAGATTCCCACGTCC -3'
(R):5'- TTCCTGTCTTGGAAATGCAGG -3'

Sequencing Primer
(F):5'- AATGGCAAAAGTTTCATGTGTTGG -3'
(R):5'- GGTTTTTCCTAGAGCAGAACAACCG -3'
Posted On2014-11-12